Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
20	86.5 cM	z3954	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
20	720.16 cR	Z3954	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
20	3920.0 cR	z3954	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z7171	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
cdh2	GENE	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z21170	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z23564	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z9343	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z10056	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
z9794	SSLP	20		Masai et al., 2003	Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).
nkx2.2b	GENE	20		Schäfer et al., 2005	Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626. Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626.
z13626	SSLP	20		Schäfer et al., 2005	Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626. Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626.

OTHER MAPPING INFORMATION

Chr 20 Masai et al., 2003 Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of  ... Masai et al. (2003 Dev. 130:2479-2494) reported no recombination between the rw95 allele of pac and the SSLP z9343 in 290 meioses (<0.35 cM).   Chr 20 Schäfer et al., 2005 Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626. Schafer M et al. mapped nkx2.2b to LG20 between markers Z3954 and Z13626.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	163,181
Forward Primer	AATGGTGTAGAAACCCTGCG
Reverse Primer	AAACGCACTAAACATCTCTCTTG
AB	277
Forward Primer	AATGGTGTAGAAACCCTGCG
Reverse Primer	AAACGCACTAAACATCTCTCTTG