Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	100.9 cM	z1798	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	219.5 cM	z1798	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	279.02 cR	Z1798	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	7327.0 cR	z1798	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z8218	SSLP	7	1.0 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z5467	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6483	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1713	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11122	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.

OTHER MAPPING INFORMATION

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	NA
Forward Primer	ATGGCATGCATTTTACTAACGG
Reverse Primer	CGAATCGTGGCCCTGACCGT
AB	NA
Forward Primer	ATGGCATGCATTTTACTAACGG
Reverse Primer	CGAATCGTGGCCCTGACCGT