| ZFIN ID: ZDB-SSLP-980528-28 |
| SSLP: | z8208 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 3 | 38.5 cM | z8208 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 3 | 105.31 cR | Z8208 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 3 | 856.0 cR | z8208 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z14228 | SSLP | 3 | Plaster et al., 2006 | Plaster, et al. (2006. Cell Death Differ. 13:223-23) reports mapping ta53c to ... | |
| ta53c | Feature | 3 | Plaster et al., 2006 | Plaster, et al. (2006. Cell Death Differ. 13:223-23) reports mapping ta53c to ... |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 0,137 | 60.0 | |
| Forward Primer | CCATAGGGGGTTTTCTGGTT | ||
| Reverse Primer | CCTGGGACACCATAAACCAT | ||
| AB | 0,143 | 60.0 | |
| Forward Primer | CCATAGGGGGTTTTCTGGTT | ||
| Reverse Primer | CCTGGGACACCATAAACCAT | ||
| TU | 0,131 | 60.0 | |
| Forward Primer | CCATAGGGGGTTTTCTGGTT | ||
| Reverse Primer | CCTGGGACACCATAAACCAT | ||
| EKW | 167,0,155 | 60.0 | |
| Forward Primer | CCATAGGGGGTTTTCTGGTT | ||
| Reverse Primer | CCTGGGACACCATAAACCAT |