| ZFIN ID: ZDB-SSLP-980528-256 |
| SSLP: | z1523 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 14 | 2.3 cM | z1523 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 14 | 21.2 cM | z1523 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 14 | 53.41 cR | Z1523 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 14 | 35.0 cR | z1523 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z5436 | SSLP | 14 | Söllner et al., 2004 | Sollner et al 2004 (Development, Genes and Evolution 214:582-590) reported linkage of tm317d to z1523 with 0 recombinants out of 96 meioses, linkage with z5436 with 3 recombinants in 96 meioses, and linkage with z25920. The TM51 RH panel was used. | |
| z25920 | SSLP | 14 | Söllner et al., 2004 | Sollner et al 2004 (Development, Genes and Evolution 214:582-590) reported linkage of tm317d to z1523 with 0 recombinants out of 96 meioses, linkage with z5436 with 3 recombinants in 96 meioses, and linkage with z25920. The TM51 RH panel was used. | |
| tm317d | Feature | 14 | Söllner et al., 2004 | Sollner et al 2004 (Development, Genes and Evolution 214:582-590) reported linkage of tm317d to z1523 with 0 recombinants out of 96 meioses, linkage with z5436 with 3 recombinants in 96 meioses, and linkage with z25920. The TM51 RH panel was used. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | NA | ||
| Forward Primer | GATCACAGCCGCTTCGTCAA | ||
| Reverse Primer | CCAAACCATTCAGACTGGATGA | ||
| IND | NA | ||
| Forward Primer | GATCACAGCCGCTTCGTCAA | ||
| Reverse Primer | CCAAACCATTCAGACTGGATGA |