Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	70.6 cM	z1239	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	162.4 cM	z1239	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	281.17 cR	Z1239	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	147.9 cM	z1239	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z41496	SSLP	7		Langenbacher et al., 2011	Langenbacher, et al. (2011. Dev. Biol. 353:19-28.) reports mapping the la961  ... Langenbacher, et al. (2011. Dev. Biol. 353:19-28.) reports mapping the la961 locus to LG7 between z1239 and z41496 on the MGH microsatellite map.
la961	Feature	7	0.6 cM	Langenbacher et al., 2011	Langenbacher, et al. (2011. Dev. Biol. 353:19-28.) reports mapping the la961  ... Langenbacher, et al. (2011. Dev. Biol. 353:19-28.) reports mapping the la961 locus to LG7 between z1239 and z41496 on the MGH microsatellite map.
z1798	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z5467	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6483	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the avatm94 LG 7 using a mitoic map constructed from half-tetrad analysis of 90 fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the lawts18 LG 7 using a mitoic map constructed from half-tetrad analysis of 163 fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the wegtx230 LG 7 using a mitoic map constructed from half-tetrad analysis of 114 fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3445	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7244	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z26442	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb12g02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14644	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fgf3	GENE	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64f09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fd21a02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fa11d03	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
ts18	Feature	7	13.5 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the lawts18 LG 7 using a mitoic map constructed from half-tetrad analysis of 163 fish.
z1713	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7	11.9 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11122	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z13880	SSLP	7	17.8 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z20715	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fi19d09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
tx230	Feature	7	8.4 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the wegtx230 LG 7 using a mitoic map constructed from half-tetrad analysis of 114 fish.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fc89b01	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
dtv43	Feature	7	7.1 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the habdtb43 LG 7 using a mitoic map constructed from half-tetrad analysis of 222 fish.
tm94	Feature	7	15.2 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the avatm94 LG 7 using a mitoic map constructed from half-tetrad analysis of 90 fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64c10	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8540	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
j108e1	Feature	7		Rawls et al., 2003	Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7  ... Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7 near z1239 and z1535.
z1535	SSLP	7		Rawls et al., 2003	Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7  ... Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7 near z1239 and z1535.

OTHER MAPPING INFORMATION

Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.   Chr 7 Rawls et al., 2003 Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7 near z1239 and z1535. Rawls, et al. (2003. Genetics. 163:997-1009) reports mapping j108e1 to LG7 near z1239 and z1535.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	221,197		60.0
Forward Primer	TATGCGGACAATGCAGTCTT
Reverse Primer	CGTTCTCCTCCTCCTGAGTG
IND	0,269,237		60.0
Forward Primer	TATGCGGACAATGCAGTCTT
Reverse Primer	CGTTCTCCTCCTCCTGAGTG
TL	175		60.0
Forward Primer	TATGCGGACAATGCAGTCTT
Reverse Primer	CGTTCTCCTCCTCCTGAGTG
TU	263,175		60.0
Forward Primer	TATGCGGACAATGCAGTCTT
Reverse Primer	CGTTCTCCTCCTCCTGAGTG