| ZFIN ID: ZDB-SSLP-980528-1896 |
| SSLP: | z21243 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 22 | 43.3 cM | z21243 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 22 | 167.5 cM | z21243 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 22 | 263.12 cR | Z21243 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 22 | 3702.0 cR | z21243 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 22 | 58.8 cM | z21243 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| cl500 | Feature | 22 | Gupta et al., 2011 | ||
| z9084 | SSLP | 22 | Gupta et al., 2011 | ||
| dag1 | GENE | 22 | 0.1 cR | Parsons et al., 2002 | Parsons, et al. (2002. Development 129:3505-3512.) report mapping dag1 to LG22 approximately 0.1 cR away from z21243 on the LN54 mapping panel. dag1 mapped adjacent to fb83d06 which is a 3' fragment of the dag1 gene. |
| fb83d06 | EST | 22 | Parsons et al., 2002 | Parsons, et al. (2002. Development 129:3505-3512.) report mapping dag1 to LG22 approximately 0.1 cR away from z21243 on the LN54 mapping panel. dag1 mapped adjacent to fb83d06 which is a 3' fragment of the dag1 gene. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 201 | 60.0 | |
| Forward Primer | TCGACATGCCAATAACACGT | ||
| Reverse Primer | TGACACATTCAGTGGCCATT | ||
| IND | 0,193 | 60.0 | |
| Forward Primer | TCGACATGCCAATAACACGT | ||
| Reverse Primer | TGACACATTCAGTGGCCATT | ||
| EKW | 0,227,211 | 60.0 | |
| Forward Primer | TCGACATGCCAATAACACGT | ||
| Reverse Primer | TGACACATTCAGTGGCCATT | ||
| TU | 0,195 | 60.0 | |
| Forward Primer | TCGACATGCCAATAACACGT | ||
| Reverse Primer | TGACACATTCAGTGGCCATT |