| ZFIN ID: ZDB-GENE-980526-90 | 
| Gene Name: | achaete-scute family bHLH transcription factor 1a | 
|---|---|
| Symbol: | ascl1a | 
PHYSICAL MAP AND BROWSER
                    
                    
                
            
        
    
    
        
        
            
    
    
    | 
            
            
                
                
                    
                     | 
        ||||||||||||||||||||||||||||
                
  | 
        
| Mapped Clones containing ascl1a | |
|---|---|
| CH211-260P3 | Chr: 4 Details | 
| DKEY-264K15 | Chr: 4 Details | 
PHYSICAL MAPPING 
                    
                    
                
            
        
    
    
        
        
    | Feature | Chr | Position | Assembly | Source | DetailedSource | Citations | 
|---|---|---|---|---|---|---|
| t25215 | 18 | GRCz11 | GENERAL_LOAD | load data [singleton] | ||
| ascl1a_unspecified | 4 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 4 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 4 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| t25215 | 4 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 4 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 4 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 4 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 | |||
| 4 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 | 
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 4 | 109.6 cM | zasha | Mother of Pearl (MOP) | Postlethwait, John H. | Data | 
| 4 | 211.74 cR | zash-a | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data | 
| 4 | 43.07 cM | asha | Gates et al (GAT) | Talbot, William S. | Data | 
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location.  Physical map location should be used whenever possible.  | 
    |||||
| Genomic Feature t25215 is an allele of ascl1a | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
                    
    
  | 
            ||||||||||||||||||||
| Genomic Feature t25215 is an allele of ascl1a | |||
|---|---|---|---|
                    
  | 
            
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| SJD | 978 | 36.0 | |
| Forward Primer | CAACTTCTGGACGAGCATGA | ||
| Reverse Primer | TTCTGAGGGAGGCAAAACC |