ZFIN ID: ZDB-GENE-980526-72

Mapping Details

Gene Name: retinoic acid receptor, alpha b
Symbol: rarab
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 3 31,872,527 - 32,087,230 GRCz12tu
NCBI Map Viewer 3 31,872,527 - 32,087,230 GRCz12tu
Ensembl 3 33,066,004 - 33,113,879 GRCz11
NCBI Map Viewer 3 33,064,437 - 33,277,633 GRCz11
UCSC 3 - GRCz11
Vega 3 32,934,290 - 33,127,907 GRCv10
Mapped Clones containing rarab
CH211-196P24 Chr: 3 Details
DKEY-242N9 Chr: 3 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa20057 3 31,877,298 GRCz12tu DIRECT Sealy et al., 2025
3 33,069,208 GRCz11 DIRECT Busch-Nentwich et al., 2013
3 32,937,494 GRCz10 DIRECT Busch-Nentwich et al., 2013
3 33,206,184 Zv9 DIRECT Busch-Nentwich et al., 2013
sa20058 3 31,877,969 GRCz12tu DIRECT Sealy et al., 2025
3 33,069,879 GRCz11 DIRECT Busch-Nentwich et al., 2013
3 32,938,165 GRCz10 DIRECT Busch-Nentwich et al., 2013
3 33,206,855 Zv9 DIRECT Busch-Nentwich et al., 2013
la015178Tg 3 33,225,179 - 33,225,189 Zv9 ZFIN_Zv9 BurgessLin
la015179Tg 3 33,245,756 - 33,245,766 Zv9 ZFIN_Zv9 BurgessLin
la024132Tg 3 33,227,345 - 33,227,355 Zv9 ZFIN_Zv9 BurgessLin
la024134Tg 3 33,275,879 - 33,275,889 Zv9 ZFIN_Zv9 BurgessLin
la028902Tg 3 33,257,278 - 33,257,288 Zv9 ZFIN_Zv9 BurgessLin
la015178Tg 3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la015179Tg 3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la024132Tg 3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
la024134Tg 3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la028902Tg 3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa20057 3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa20058 3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
3 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
3 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 75.2 cM rara2b Mother of Pearl (MOP) Postlethwait, John H. Data
3 51.6 cM rara2b Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by rarab
fj66e06 Chr: 3 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1068 DdeI 56.0
Forward Primer GAGGGTCTGGAGGGAGGC
Reverse Primer GGGGGTCTCTGTGTCTTTCG
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.