ZFIN ID: ZDB-GENE-980526-419

Mapping Details

Gene Name: LIM domain only 2 (rhombotin-like 1)
Symbol: lmo2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 18 41,217,217 - 41,224,994 GRCz12tu
NCBI Map Viewer 18 41,217,217 - 41,224,994 GRCz12tu
Ensembl 18 38,288,877 - 38,296,665 GRCz11
NCBI Map Viewer 18 38,288,877 - 38,296,665 GRCz11
UCSC 18 - GRCz11
Vega 18 38,307,869 - 38,315,657 GRCv10
Mapped Clones containing lmo2
DKEY-10O6 Chr: 18 Details
CH73-110E4 Chr: 18 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
bns499 18 38,295,654 GRCz11 DIRECT Mattonet et al., 2022
bns500 18 38,295,654 - 38,295,659 GRCz11 DIRECT Mattonet et al., 2022
vu270 18 38,295,634 GRCz11 DIRECT Weiss et al., 2012
zf3558 18 38,290,738 - 38,290,739 GRCz11 DIRECT Matrone et al., 2021
bns499 18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
18 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
bns500 18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
18 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
pku684ld 18 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
vu270 18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
18 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
zf3558 18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
18 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
18 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
18 102.7 cM lmo2 Mother of Pearl (MOP) Postlethwait, John H. Data
18 425.72 cR lmo2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
18 3718.0 cR lmo2 Goodfellow T51 (T51) Geisler, Robert Data
18 86.6 cM lmo2 Heat Shock (HS) Woods, Ian G. Data
18 60.9 cM lmo2 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z3853 SSLP 18 Matthews et al., 2004 Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
onecut1 GENE 18 30.0 cR Matthews et al., 2004 Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
fc83a08 EST 18 Matthews et al., 2004 Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
fb96a11 EST 18 Matthews et al., 2004 Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.

OTHER MAPPING INFORMATION
Markers Encoded by lmo2
fc83a08 Chr: 18 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD HhaI 36.0
Forward Primer CCACAAACAAGACGGAGCCTA
Reverse Primer CGCACAAACGCTTCAGAGAT