Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 17 42,565,998 - 42,568,498 GRCz11 Ensembl 17 42,565,998 - 42,568,498 GRCz11 Vega 17 42,290,592 - 42,293,092 GRCv10 NCBI Map Viewer 17 42,565,998 - 42,568,438 GRCz11 UCSC 17 - GRCv10

Mapped Clones containing foxa2
DKEY-208C12	Chr: 17 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
17	165.0 cM	axial	Mother of Pearl (MOP)	Postlethwait, John H.	Data
17	333.51 cR	foxa2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
17	4132.0 cR	foxa2	Goodfellow T51 (T51)	Geisler, Robert	Data
17	98.8 cM	foxa2	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
tv53a	Feature	17		Norton et al., 2005	Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.

OTHER MAPPING INFORMATION

Chr 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the  ... Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.

Markers Encoded by foxa2
fe05g04 Chr: 17 Details
tdsubc_2g8 Chr: 17 Details

Genomic Feature st20 is an allele of foxa2
Marker Type Chr Distance Publication / Person Comments z9830 SSLP 17 5.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped molst20 to LG17 using SSLP markers. z21703 SSLP 17 5.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped molst20 to LG17 using SSLP markers.

Genomic Feature tv53a is an allele of foxa2

Marker Type Chr Distance Publication / Person Comments z21703 SSLP 17 2.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 using SSLP markers. z21194 SSLP 17 9.0 cM Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 using SSLP markers. foxa2 GENE 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.

Genomic Feature tv53a is an allele of foxa2
Chr 17 Norton et al., 2005 Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the  ... Norton et al. (2005, Development 132(4):645-658) mapped moltv53a to LG17 at the same position as foxa2.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	454	Tsp509I	36.0
Forward Primer	GACATACGAGCAAGTGATGCA
Reverse Primer	GCGAAAAAAGTCCAAATAACA