ZFIN ID: ZDB-GENE-980526-284

Mapping Details

Gene Name: retinoic acid receptor, alpha a
Symbol: raraa
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 12 11,386,769 - 11,711,599 GRCz12tu
NCBI Map Viewer 12 11,386,769 - 11,711,599 GRCz12tu
Ensembl 12 10,952,794 - 11,157,237 GRCz11
NCBI Map Viewer 12 10,833,072 - 11,157,569 GRCz11
UCSC 12 - GRCz11
Vega 12 10,914,491 - 11,118,934 GRCv10
Mapped Clones containing raraa
DKEY-56E5 Chr: 12 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa31860 12 11,684,203 GRCz12tu DIRECT Sealy et al., 2025
12 11,129,847 GRCz11 DIRECT Busch-Nentwich et al., 2013
12 11,091,544 GRCz10 DIRECT Busch-Nentwich et al., 2013
12 12,235,891 Zv9 DIRECT Busch-Nentwich et al., 2013
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
12 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
12 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 162.07 cR rara2a Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
12 1550.0 cR rara2a Goodfellow T51 (T51) Geisler, Robert Data
12 38.3 cM rara2a Heat Shock (HS) Woods, Ian G. Data
12 36.17 cM rara2a Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
top2a GENE 12 Hale et al., 2006
z23536 SSLP 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
z4373 SSLP 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
z9891 SSLP 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
z10806 SSLP 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
fc05c04 EST 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
w24 Feature 12 1.6 cM Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
fb57a07 EST 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
z15261 SSLP 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.
fb04b08 EST 12 Pietsch et al., 2006 Pietsch et al. (2006, Development 133(3):395-406) mapped lessenw24 to LG24 using bulk segregant analysis.

OTHER MAPPING INFORMATION
Chr 12 Hale et al., 2006
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 362 36.0
Forward Primer CAGTTGTAGCCCCTCCCTCT
Reverse Primer AGTCTCTGGTCATTGCAGGC