ZFIN ID: ZDB-GENE-980526-16

ZFIN ID: ZDB-GENE-980526-16

Mapping Details

Gene Name:	endothelin receptor Ba
Symbol:	ednrba

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	1	32,142,682 - 32,172,619	GRCz12tu
NCBI Map Viewer	1	32,142,682 - 32,172,619	GRCz12tu
NCBI Map Viewer	1	28,603,768 - 28,629,624	GRCz11

Mapped Clones containing ednrba
BUSM1-27N24	Chr: 1 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
j3e1	1	28,627,337	GRCz11	DIRECT		Parichy et al., 2000
j3e2	1	28,628,257	GRCz11	DIRECT		Parichy et al., 2000
j3e3	1	28,628,088	GRCz11	DIRECT		Parichy et al., 2000
b140	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
ihb437	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
ihb441	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
j3e1	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
j3e2	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
j3e3	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
j3e988	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
j3e1527	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
tan17X	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
tlf802	1		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	1		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
1	82.1 cM	ednrb1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
1	266.9 cR	ednrb1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
1	3231.0 cR	ednrb1	Goodfellow T51 (T51)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
bmp1l	GENE	1		Reifers et al., 2000	fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.
pou4f1	GENE	1		Reifers et al., 2000	fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.
fgf8b	GENE	1	17.5 cM	Reifers et al., 2000	fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	340	AluI	36.0
Forward Primer	CACTGTGCTGGCTTCCACTG
Reverse Primer	ATTCTTAAAGCGCTTGCTAACCAT