ZFIN ID: ZDB-GENE-980526-115

Mapping Details

Gene Name: nuclear receptor subfamily 2, group F, member 1a
Symbol: nr2f1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
Vega 5 49,093,202 - 49,100,038 GRCv10
NCBI Map Viewer 5 49,744,782 - 49,751,528 GRCz11
Mapped Clones containing nr2f1a
DKEYP-10A3 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
ci1009 5 49,747,221 - 49,747,269 GRCz11 Duong et al., 2017
ci1017 5 49,745,315 - 49,745,372 GRCz11 Gafranek et al., 2023
el512 5 49,745,891 - 49,745,898 GRCz11 Barske et al., 2018
sa11358 5 49,745,762 GRCz11 Busch-Nentwich et al., 2013
5 49,094,251 GRCz10 Busch-Nentwich et al., 2013
5 51,528,553 Zv9 Busch-Nentwich et al., 2013
sa14691 5 49,750,408 GRCz11 Busch-Nentwich et al., 2013
5 49,098,897 GRCz10 Busch-Nentwich et al., 2013
5 51,533,199 Zv9 Busch-Nentwich et al., 2013
sa20527 5 49,745,697 GRCz11 Busch-Nentwich et al., 2013
5 49,094,186 GRCz10 Busch-Nentwich et al., 2013
5 51,528,488 Zv9 Busch-Nentwich et al., 2013
sa40551 5 49,750,320 GRCz11 Busch-Nentwich et al., 2013
5 49,098,809 GRCz10 Busch-Nentwich et al., 2013
5 51,533,111 Zv9 Busch-Nentwich et al., 2013
sa45227 5 49,750,346 GRCz11 Busch-Nentwich et al., 2013
5 49,098,835 GRCz10 Busch-Nentwich et al., 2013
5 51,533,137 Zv9 Busch-Nentwich et al., 2013
sud21 5 49,745,798 - 49,745,801 GRCz11 Chowdhury et al., 2024
ci1009 5 GRCz11
5 GRCz11
5 GRCz11
ci1017 5 GRCz11
5 GRCz11
5 GRCz11
el512 5 GRCz11
5 GRCz11
5 GRCz11
sa11358 5 GRCz11
5 GRCz11
5 GRCz11
sa14691 5 GRCz11
5 GRCz11
5 GRCz11
sa20527 5 GRCz11
5 GRCz11
5 GRCz11
sa40551 5 GRCz11
5 GRCz11
5 GRCz11
sa45227 5 GRCz11
5 GRCz11
5 GRCz11
sud21 5 GRCz11
5 GRCz11
5 GRCz11

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
5 145.3 cM svp44 Mother of Pearl (MOP) Postlethwait, John H. Data
5 3541.0 cR nr2f1 Goodfellow T51 (T51) Geisler, Robert Data
5 96.6 cM nr2f1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 963 HinFI 36.0
Forward Primer TGTTATTATCCGGGAGCAGC
Reverse Primer TGCACAGGCATATCATGGAT
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.