Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 5 37,837,245 - 37,839,310 GRCz11 Ensembl 5 37,837,245 - 37,839,310 GRCz11 Vega 5 37,237,092 - 37,239,157 GRCv10 NCBI Map Viewer 5 37,837,245 - 37,839,310 GRCz11 UCSC 5 - GRCv10

Mapped Clones containing epd
CH211-139A5	Chr: 5 Details
CH211-69I14	Chr: 5 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
5	105.8 cM	epd	Mother of Pearl (MOP)	Postlethwait, John H.	Data
5	2891.0 cR	epd	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
apoa1a	GENE	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
dmrt2a	GENE	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
z8122	SSLP	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
zehn1245	EST	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
atp1b2b	GENE	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.
ins	GENE	5		Rajarao et al., 2002	Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.

OTHER MAPPING INFORMATION

Chr 5 Rajarao et al., 2002 Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to  ... Rajarao, et al. (2002. Dev Dyn 223:254-261.) reports mapping atp1b2b to LG05 close to apoa, ins, terra, epd, and zehn1245 at position 87.8 cM on the HS mapping panel. They confirm this linkage assignment by mapping atp1b2b to LG05 near z8122 on the T51 mapping panel.

Markers Encoded by epd
fj34b05 Chr: 5 Details

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	851	SspI	36.0
Forward Primer	GCTGACCAGTGGAACGATGA
Reverse Primer	CGTGAGTGGTGTCCTCAACA