ZFIN ID: ZDB-GENE-980526-437

Mapping Details

Gene Name: T-box transcription factor Ta
Symbol: tbxta
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 19 15,329,574 - 15,333,686 GRCz12tu
NCBI Map Viewer 19 15,329,574 - 15,333,686 GRCz12tu
Ensembl 19 14,187,540 - 14,191,592 GRCz11
NCBI Map Viewer 19 14,187,540 - 14,191,592 GRCz11
UCSC 19 - GRCz11
Vega 19 14,325,345 - 14,329,397 GRCv10
Mapped Clones containing tbxta
CH73-285B23 Chr: 19 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
b160 19 14,190,079 - 14,190,080 GRCz11 DIRECT Schulte-Merker et al., 1994
sa13983 19 15,332,911 GRCz12tu DIRECT Sealy et al., 2025
19 14,190,817 GRCz11 DIRECT Busch-Nentwich et al., 2013
19 14,328,622 GRCz10 DIRECT Busch-Nentwich et al., 2013
19 30,637,134 Zv9 DIRECT Busch-Nentwich et al., 2013
b160 19 GRCz11 GENERAL_LOAD load data [singleton]
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
b195 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
b459 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
b487 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
kt338 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
kt501a 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
kt633 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
m147 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
m550 19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa13983 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
tb244e 19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tbxta_unspecified 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
tc41 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
ts260 19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
w181 19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
zf3096Tg 19 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
19 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
19 69.4 cM ntl Mother of Pearl (MOP) Postlethwait, John H. Data
19 154.98 cR ntl Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
19 66.6 cM ntl Heat Shock (HS) Woods, Ian G. Data
19 38.25 cM ntl Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by tbxta
fc80a01 Chr: 19 Details
Genomic Feature b160 is an allele of tbxta
Chr 19 Postlethwait et al., 1994 Postlethwait, et al. (1994. Science 264:699-703.) mapped the no tail mutation (allele: b160) to  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 921 HinFI 36.0
Forward Primer CCTCCTCAATGTACGATCCA
Reverse Primer TCAAAGAGCCCAACAAATACA
Genomic Feature tc41 is an allele of tbxta