ZFIN ID: ZDB-GENE-980526-137

Mapping Details

Gene Name:	cholinergic receptor, nicotinic, alpha 1 (muscle)
Symbol:	chrna1

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	6	11,770,874 - 11,787,460	GRCz12tu
NCBI Map Viewer	6	11,770,874 - 11,787,460	GRCz12tu
Ensembl	6	10,812,337 - 10,828,923	GRCz11
NCBI Map Viewer	6	10,812,337 - 10,828,923	GRCz11
UCSC	6	-	GRCz11
Vega	6	10,576,910 - 10,593,496	GRCv10

Mapped Clones containing chrna1
DKEY-91G17	Chr: 6 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
dtbn12	6	10,818,399	GRCz11	DIRECT		ZFIN Curated Data
b107	6		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
b817	6		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
dtbn12	6		GRCz11	OTHER_MAPPING	linkagesDirectMem2
	6		GRCz11	OTHER_MAPPING	paneledMarkersDirect
	6		GRCz11	OTHER_MAPPING	directMappedMarker
	6		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	6		GRCz11	OTHER_MAPPING	linkagesDirectMem1
tk48d	6		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	6		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
6	59.8 cM	nic1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
6	1183.0 cR	chrna1	Goodfellow T51 (T51)	Geisler, Robert	Data
6	28.0 cM	chrna1	Heat Shock (HS)	Woods, Ian G.	Data
6	39.57 cM	chrna1	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Genomic Feature dtbn12 is an allele of chrna1

Chr	Location	Mapped As	Panel	Mapped By	Scoring
6	31.1 cM	dtbn12	Boston MGH Cross (MGH)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Genomic Feature dtbn12 is an allele of chrna1

Marker	Type	Chr	Distance	Publication / Person	Comments
z6601	SSLP	6	0.77 cM	Lefebvre et al., 2004	Lefebvre et al. (2004) reported mapping the twister locus to 0.77 cM ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	280		36.0
Forward Primer	TCAGACCACATGCTCAGTCAG
Reverse Primer	GGTAACCATGAAAAACGCAGA

Genomic Feature tk48d is an allele of chrna1