ZFIN ID: ZDB-GENE-980526-419

ZFIN ID: ZDB-GENE-980526-419

Mapping Details

Gene Name:	LIM domain only 2 (rhombotin-like 1)
Symbol:	lmo2

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	18	41,217,217 - 41,224,994	GRCz12tu
NCBI Map Viewer	18	41,217,217 - 41,224,994	GRCz12tu
Ensembl	18	38,288,877 - 38,296,665	GRCz11
NCBI Map Viewer	18	38,288,877 - 38,296,665	GRCz11
UCSC	18	-	GRCz11
Vega	18	38,307,869 - 38,315,657	GRCv10

Mapped Clones containing lmo2
DKEY-10O6	Chr: 18 Details
CH73-110E4	Chr: 18 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
bns499	18	38,295,654	GRCz11	DIRECT		Mattonet et al., 2022
bns500	18	38,295,654 - 38,295,659	GRCz11	DIRECT		Mattonet et al., 2022
vu270	18	38,295,634	GRCz11	DIRECT		Weiss et al., 2012
zf3558	18	38,290,738 - 38,290,739	GRCz11	DIRECT		Matrone et al., 2021
bns499	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
bns500	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
pku684ld	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
vu270	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
zf3558	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	18		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	18		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
18	102.7 cM	lmo2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
18	425.72 cR	lmo2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
18	3718.0 cR	lmo2	Goodfellow T51 (T51)	Geisler, Robert	Data
18	86.6 cM	lmo2	Heat Shock (HS)	Woods, Ian G.	Data
18	60.9 cM	lmo2	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
z3853	SSLP	18		Matthews et al., 2004	Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
onecut1	GENE	18	30.0 cR	Matthews et al., 2004	Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
fc83a08	EST	18		Matthews et al., 2004	Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.
fb96a11	EST	18		Matthews et al., 2004	Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel.

Markers Encoded by lmo2
fc83a08 Chr: 18 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD		HhaI	36.0
Forward Primer	CCACAAACAAGACGGAGCCTA
Reverse Primer	CGCACAAACGCTTCAGAGAT

Genomic Feature bns499 is an allele of lmo2