ZFIN ID: ZDB-GENE-980526-35

Mapping Details

Gene Name: transferrin-a
Symbol: tfa
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 2 19,151,089 - 19,162,699 GRCz12tu
NCBI Map Viewer 2 19,151,089 - 19,162,699 GRCz12tu
Ensembl 2 16,780,643 - 16,792,188 GRCz11
NCBI Map Viewer 2 16,780,634 - 16,792,177 GRCz11
UCSC 2 - GRCz11
Vega 2 17,112,053 - 17,123,598 GRCv10
Mapped Clones containing tfa
DKEY-263H23 Chr: 19 Details
CH73-211A15 Chr: 2 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa12059 2 19,156,045 GRCz12tu DIRECT Sealy et al., 2025
2 16,785,590 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 17,117,000 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 16,587,983 Zv9 DIRECT Busch-Nentwich et al., 2013
sa15651 2 19,162,170 GRCz12tu DIRECT Sealy et al., 2025
2 16,791,648 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 17,123,058 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 16,581,925 Zv9 DIRECT Busch-Nentwich et al., 2013
sa19720 2 19,154,088 GRCz12tu DIRECT Sealy et al., 2025
2 16,783,633 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 17,115,043 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 16,589,940 Zv9 DIRECT Busch-Nentwich et al., 2013
sa32878 2 19,158,121 GRCz12tu DIRECT Sealy et al., 2025
2 16,787,666 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 17,119,076 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 16,585,907 Zv9 DIRECT Busch-Nentwich et al., 2013
sa32879 2 19,153,940 GRCz12tu DIRECT Sealy et al., 2025
2 16,783,485 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 17,114,895 GRCz10 DIRECT Busch-Nentwich et al., 2013
2 16,590,088 Zv9 DIRECT Busch-Nentwich et al., 2013
sa44526 2 19,158,121 GRCz12tu DIRECT Sealy et al., 2025
2 16,787,666 GRCz11 DIRECT Busch-Nentwich et al., 2013
2 16,585,907 Zv9 DIRECT Busch-Nentwich et al., 2013
tzhe067 2 GRCz11 GENERAL_LOAD load data [singleton]
sa12059 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa15651 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa19720 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa32878 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa32879 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa44526 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tzhe067 2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING linkagesDirectMem2
2 GRCz11 OTHER_MAPPING linkagesDirectMem1
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tzit029 2 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
2 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 77.0 cM tfa Mother of Pearl (MOP) Postlethwait, John H. Data
2 203.87 cR tfa Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
2 2024.0 cR tfa Goodfellow T51 (T51) Geisler, Robert Data
2 37.69 cM tfa Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by tfa
fb62h02 Chr: 2 Details
IMAGE:3815706 Chr: 2 Details
Genomic Feature tzhe067 is an allele of tfa
Marker Type Chr Distance Publication / Person Comments
z9354 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ...
z4300 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ...
z26250 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ...
Genomic Feature tzhe067 is an allele of tfa
Chr 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 167 36.0
Forward Primer CGATATGATTGAGAGGACCTACAA
Reverse Primer TCATTTCATCCCCTTTTGTGATA
Genomic Feature sa44526 is an allele of tfa