ZFIN ID: ZDB-GENE-980526-332

Mapping Details

Gene Name: wingless-type MMTV integration site family, member 8a
Symbol: wnt8a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN JBrowse 14 34,490,445 - 34,494,899 GRCz11
ZFIN JBrowse 14 34,495,216 - 34,497,724 GRCz11
Ensembl 14 34,490,445 - 34,494,899 GRCz11
Ensembl 14 34,495,216 - 34,497,724 GRCz11
Vega 14 34,154,902 - 34,157,410 GRCv10
Vega 14 34,150,131 - 34,154,585 GRCv10
Vega 14 34,150,131 - 34,157,410 GRCv10
Mapped Clones containing wnt8a
CH211-232M8 Chr: 14 Details
CH211-11C15 Chr: 14 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
nub14 14 34,492,787 - 34,492,790 GRCz11 DIRECT Hino et al., 2017
nub15 14 34,492,786 - 34,492,801 GRCz11 DIRECT Hino et al., 2017
nub16 14 34,497,122 - 34,497,131 GRCz11 DIRECT Hino et al., 2017
nub17 14 34,497,121 - 34,497,129 GRCz11 DIRECT Hino et al., 2017
nub18 14 34,497,122 - 34,497,137 GRCz11 DIRECT Hino et al., 2017
nub22 14 34,492,786 - 34,497,132 GRCz11 DIRECT Hino et al., 2017
sa1188 14 39,100,137 GRCz12tu DIRECT Sealy et al., 2025
14 34,495,914 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,155,600 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,626,323 Zv9 DIRECT Busch-Nentwich et al., 2013
sa11601 14 39,099,782 GRCz12tu DIRECT Sealy et al., 2025
14 34,495,569 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,155,255 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,625,978 Zv9 DIRECT Busch-Nentwich et al., 2013
sa31997 14 39,099,517 GRCz12tu DIRECT Sealy et al., 2025
14 34,495,303 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,154,989 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,625,712 Zv9 DIRECT Busch-Nentwich et al., 2013
sa35723 14 39,096,515 GRCz12tu DIRECT Sealy et al., 2025
14 34,492,316 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,152,002 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,622,725 Zv9 DIRECT Busch-Nentwich et al., 2013
sa42419 14 39,101,371 GRCz12tu DIRECT Sealy et al., 2025
14 34,497,149 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,156,835 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,627,558 Zv9 DIRECT Busch-Nentwich et al., 2013
sa44812 14 39,098,230 GRCz12tu DIRECT Sealy et al., 2025
14 34,494,016 GRCz11 DIRECT Busch-Nentwich et al., 2013
14 34,153,702 GRCz10 DIRECT Busch-Nentwich et al., 2013
14 35,624,425 Zv9 DIRECT Busch-Nentwich et al., 2013
la011030Tg 14 35,623,444 - 35,623,454 Zv9 ZFIN_Zv9 BurgessLin
la018995Tg 14 35,621,713 - 35,621,723 Zv9 ZFIN_Zv9 BurgessLin
la011030Tg 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la018995Tg 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
nub14 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
nub15 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
nub16 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
nub17 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
nub18 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
nub19 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
nub20 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
nub21 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
nub22 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa1188 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa11601 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
sa31997 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa35723 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa42419 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa44812 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
14 120.0 cM wnt8 Mother of Pearl (MOP) Postlethwait, John H. Data
14 600.38 cR wnt8 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
14 4513.0 cR wnt8 Goodfellow T51 (T51) Geisler, Robert Data
14 89.3 cM wnt8 Heat Shock (HS) Woods, Ian G. Data
14 71.88 cM wnt8 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by wnt8a
fe05d07 Chr: 14 Details
fa20e02 Chr: 14 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 210 MwoI 36.0
Forward Primer GCGGTCAACCTGCATAACAA
Reverse Primer CTGCATCCAGCATGTCTGAA
Genomic Feature nub22 is an allele of wnt8a