ZFIN ID: ZDB-GENE-980526-392

Mapping Details

Gene Name: synaptosome associated protein 25b
Symbol: snap25b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 13,500,178 - 13,587,592 GRCz12tu
NCBI Map Viewer 17 13,500,178 - 13,587,592 GRCz12tu
Ensembl 17 12,297,984 - 12,385,308 GRCz11
NCBI Map Viewer 17 12,297,984 - 12,385,312 GRCz11
UCSC 17 - GRCz11
Vega 17 12,143,918 - 12,231,242 GRCv10
Mapped Clones containing snap25b
CH73-93A6 Chr: 17 Details
CH211-271I22 Chr: 17 Details
CH73-313G15 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa7432 17 13,518,854 GRCz12tu DIRECT Sealy et al., 2025
17 12,316,650 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 12,162,584 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 12,180,062 Zv9 DIRECT Busch-Nentwich et al., 2013
sa32130 17 13,539,326 GRCz12tu DIRECT Sealy et al., 2025
17 12,337,047 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 12,182,981 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 12,200,459 Zv9 DIRECT Busch-Nentwich et al., 2013
sa36346 17 13,518,749 GRCz12tu DIRECT Sealy et al., 2025
17 12,316,545 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 12,162,479 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 12,179,957 Zv9 DIRECT Busch-Nentwich et al., 2013
sbu83 17 12,384,993 - 12,385,045 GRCz11 DIRECT Moravec et al., 2016
sa7432 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa32130 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa36346 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sbu83 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
tpl27Gt 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 54.8 cM snap25b Mother of Pearl (MOP) Postlethwait, John H. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by snap25b
fj33h05 Chr: 17 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 590 RsaI 36.0
Forward Primer GACATGGCTGACTCCAACAAAA
Reverse Primer TGGCAGGCTAAGATAAG
Genomic Feature sa32130 is an allele of snap25b