ZFIN ID: ZDB-GENE-980526-284

Mapping Details

Gene Name:	retinoic acid receptor, alpha a
Symbol:	raraa

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	12	11,386,769 - 11,711,599	GRCz12tu
NCBI Map Viewer	12	11,386,769 - 11,711,599	GRCz12tu
Ensembl	12	10,952,794 - 11,157,237	GRCz11
NCBI Map Viewer	12	10,833,072 - 11,157,569	GRCz11
UCSC	12	-	GRCz11
Vega	12	10,914,491 - 11,118,934	GRCv10

Mapped Clones containing raraa
DKEY-56E5	Chr: 12 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa31860	12	11,684,203	GRCz12tu	DIRECT		Sealy et al., 2025
	12	11,129,847	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	12	11,091,544	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	12	12,235,891	Zv9	DIRECT		Busch-Nentwich et al., 2013
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	12		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	12		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
12	162.07 cR	rara2a	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
12	1550.0 cR	rara2a	Goodfellow T51 (T51)	Geisler, Robert	Data
12	38.3 cM	rara2a	Heat Shock (HS)	Woods, Ian G.	Data
12	36.17 cM	rara2a	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
top2a	GENE	12		Hale et al., 2006
z23536	SSLP	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
z4373	SSLP	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
z9891	SSLP	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
z10806	SSLP	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
fc05c04	EST	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
w24	Feature	12	1.6 cM	Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
fb57a07	EST	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
z15261	SSLP	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.
fb04b08	EST	12		Pietsch et al., 2006	Pietsch et al. (2006, Development 133(3):395-406) mapped lessen^w24 to LG24 using bulk segregant analysis.

Chr 12

Hale et al., 2006

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	362		36.0
Forward Primer	CAGTTGTAGCCCCTCCCTCT
Reverse Primer	AGTCTCTGGTCATTGCAGGC

Genomic Feature sa31860 is an allele of raraa