| ZFIN ID: ZDB-GENE-980526-419 |
| Gene Name: | LIM domain only 2 (rhombotin-like 1) |
|---|---|
| Symbol: | lmo2 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing lmo2 | |
|---|---|
| DKEY-10O6 | Chr: 18 Details |
| CH73-110E4 | Chr: 18 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| bns499 | 18 | 38,295,654 | GRCz11 | DIRECT | Mattonet et al., 2022 | |
| bns500 | 18 | 38,295,654 - 38,295,659 | GRCz11 | DIRECT | Mattonet et al., 2022 | |
| vu270 | 18 | 38,295,634 | GRCz11 | DIRECT | Weiss et al., 2012 | |
| zf3558 | 18 | 38,290,738 - 38,290,739 | GRCz11 | DIRECT | Matrone et al., 2021 | |
| bns499 | 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 18 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| bns500 | 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 18 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| pku684ld | 18 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| vu270 | 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 18 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| zf3558 | 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneLinkage | ||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 18 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 18 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 18 | 102.7 cM | lmo2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 18 | 425.72 cR | lmo2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 18 | 3718.0 cR | lmo2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 18 | 86.6 cM | lmo2 | Heat Shock (HS) | Woods, Ian G. | Data |
| 18 | 60.9 cM | lmo2 | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z3853 | SSLP | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. | |
| onecut1 | GENE | 18 | 30.0 cR | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. |
| fc83a08 | EST | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. | |
| fb96a11 | EST | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. |
| Markers Encoded by lmo2 | |||
|---|---|---|---|
| fc83a08 Chr: 18 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | HhaI | 36.0 | |
| Forward Primer | CCACAAACAAGACGGAGCCTA | ||
| Reverse Primer | CGCACAAACGCTTCAGAGAT |
| Genomic Feature pku684ld is an allele of lmo2 |