ZFIN ID: ZDB-GENE-980526-416 |
Gene Name: | wingless-type MMTV integration site family member 2 |
---|---|
Symbol: | wnt2 |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing wnt2 | |
---|---|
DKEY-270I2 | Chr: 18 Details |
CH211-238N5 | Chr: 18 Details |
PHYSICAL MAPPING
No data available
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
18 | 77.7 cM | wnt2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
18 | 1579.0 cR | wnt2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
18 | 63.6 cM | wnt2 | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
unp279 | STS | 18 | 18.0 cR | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. |
cbfb | GENE | 18 | 33.0 cR | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. |
mef2aa | GENE | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. | |
z4755 | SSLP | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. | |
z13426 | SSLP | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. | |
z5479 | SSLP | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. | |
unp4 | STS | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. | |
unp140 | STS | 18 | Blake et al., 2000 | Blake et al. (Blood 96(13):4178-4184) Report mapping cbfb to LG18 on the T51 panel using multiple markers. |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 260 | Dpn II | 36.0 |
Forward Primer | GGGGCTACGACACATCAAGA | ||
Reverse Primer | CAAAACAGCGAATAAAGACGG |
Genomic Feature hu2848 is an allele of wnt2 |