| ZFIN ID: ZDB-GENE-980526-137 |
| Gene Name: | cholinergic receptor, nicotinic, alpha 1 (muscle) |
|---|---|
| Symbol: | chrna1 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing chrna1 | |
|---|---|
| DKEY-91G17 | Chr: 6 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| dtbn12 | 6 | 10,818,399 | GRCz11 | DIRECT | ZFIN Curated Data | |
| b107 | 6 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| b817 | 6 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| dtbn12 | 6 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 | ||
| 6 | GRCz11 | OTHER_MAPPING | paneledMarkersDirect | |||
| 6 | GRCz11 | OTHER_MAPPING | directMappedMarker | |||
| 6 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 6 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 | |||
| tk48d | 6 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 6 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 6 | 59.8 cM | nic1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 6 | 1183.0 cR | chrna1 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 6 | 28.0 cM | chrna1 | Heat Shock (HS) | Woods, Ian G. | Data |
| 6 | 39.57 cM | chrna1 | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Genomic Feature dtbn12 is an allele of chrna1 | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||||||
| Genomic Feature dtbn12 is an allele of chrna1 | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 280 | 36.0 | |
| Forward Primer | TCAGACCACATGCTCAGTCAG | ||
| Reverse Primer | GGTAACCATGAAAAACGCAGA |
| Genomic Feature b817 is an allele of chrna1 |