Genomic Feature

nw2

ID
ZDB-ALT-201112-3
Name
nw2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yaksi Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 3: 60722098 - 60722102 (GRCz11) (1) Details
Nucleotide change
CACAG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TAAATAAAAGTAAATATAAGCGATTGGGGGCCGTGGGTTATCGTTTTTTTTAATGACTTTAAAACAGGATCGTCGTTATGAATGTATTTAAACTTTTTATACCCCTTGGTTTCTAGTGTTGTCGAGGGAAAATCTCTGTTTTGAGGGATAATATCCCTTCCCCTTAGCCCTACGCCTTCAAGATGAAGAGAATTGGGACACCCCTAGCCCTTCACATGAACACTAAGGGGTAAGGGGTAGAACTGGGATTGGACCTTTGACTGATCTAAATGTTTCTGCCTGTTAGGATTTGTCAGGACCATGCTCTCCATGAGTTCCATGGACCCCTGGCCGGAGGGCTCGGTGGGCTTGGAGGAGGAAGTGGTGACTGCAGCGGCTCAGGCCGAGCGTTTGGACACCTCCACACCGCTCCAGTGCAACACCAGTTTAGACTCCGACAATTTAGACGACAGCCTGACCAGCCTCCAGTGGCTGCAGGAGTTCTCCATCCTCAACGCCAG
CACAG/- GACAGCACACGTCCCCGTCTAGCCACAGCCACCTCATGGGCTCAGACGCGCCCTCTTCACCGTTAGCAGGAGACCCGGCGTCTATAGGCATGCCACTGACCCCTGGGAAACCCACGGCGGCGTCTTTCTGCAGAGTGCCCATGTTTTCAGCTCTGCCCAGCCTGGTGGCGCATGGACACTGTCCCGACGAAGTCGATTATAAGTCCAACCCGCACATCAAGCCGCCATACTCATATGCAACTCTCATATGCATGGCTATGCAGGCAAGCAAGAAAACCAAAATCACACTTTCATGCATCTACAAGTGGATCACGGACAACTTCTGCTACTTCCGCCACGCAGATCCCACCTGGCAGGTAACACATTTTCACATTGGTTTCTCAGCAGTGGAAAACAATATAGTTGGTCAACTCAGAGCGCAGTGAATAGGAGAGGACAATAGATCATTTGCGTACAATCCTATTTGCTCAAATAATAAAAGAAAAACTCCAGGATGGGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations