Transcript

nr4a1-202

ID
ZDB-TSCRIPT-131113-1381
Name
nr4a1-202
Previous Names
  • nr4a1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059218 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059218|OTTDARG00000030722|ZDB-GENE-040704-11 nr4a1|OTTDARP00000046221 nr4a1-002 LG_ CU469363.8 Danio rerio protein_coding NOVEL, 784 bp
AAAGGAAGAGCGAATCTGACACAACAGATCAATGGTGCGG
CTCCCGGTGCGGTCCACGCATCACACGCGGAAGAATGAAG
GAGATTCCGCGGCTACCCTCAGAAATAACAGGCTCGTGAA
CGAGAAAAAAGGCTTTGATCAGGAAAAAGATCCCAGCTCG
TGATAACGGCGGAAAGCAGATGTGAAGCCAGTTCTGAGTA
GACAGACAGCGACATGGAAATTGGCAAAAAAGCAACGCGG
ATGTCAAGAACCACATACATCACCAAAGGATCTCTTGGGG
TCAAATGTGCCGAGAACATGTCCAGGACATATTTAACTAT
ATTCAAAGCAAAATGACCTGTGTTCAAAGTCAACATGGAG
TCCAGTCCTACGAGAGCTCCCTCTTCAGCTCAGAGTTTCT
GAATCCTGACTTCACCTCCAGGTTGGCCATGGATGTGACC
GAGCAGCGGGAACAGCTCTCTGCGCCCTCCCTACCCAGCA
TCACTTCTCTGGTTGGGGGATACGTTGGCGAGTTTGACAC
CTACTCATGCCAGATCGCCACAGGAGCTGCTTCTACCTGT
GTGGGCAGCACCTCCGGGCAGCTGGACTCCTTCAAGCTGG
ATGACCTCCAGGTGTATGGCTGCTACCCGGGCACGTTTGC
TTTGAGCTACCTGGACGAGACGCTGTCCTCTTCGGGTGGG
TCAAACTGCTTTGGAAGTCCGGCATCTGCACCGTCTCCCT
CCACCCCGGGATACCAGCACATGTCTGCATGGGACAGCAC
CTTTGGTCCCTGCTCTCCTGACGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations