Transcript

nr4a1-201

ID
ZDB-TSCRIPT-090929-22328
Name
nr4a1-201
Previous Names
  • nr4a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042630 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042630|OTTDARG00000030722|ZDB-GENE-040704-11 nr4a1|OTTDARP00000033864 nr4a1-001 LG_ CU469363.8 Danio rerio protein_coding NOVEL, 2945 bp
GAGAAAAGCGTCTTGTCGTGGCAGGGGACGTTATACATGG
TTATCCAAATCTTGGAATACGGACACTTATAGGTCCCCCA
TCACATTACGTTTCTCAGAAATGACCTGTGTTCAAAGTCA
ACATGGAGTCCAGTCCTACGAGAGCTCCCTCTTCAGCTCA
GAGTTTCTGAATCCTGACTTCACCTCCAGGTTGGCCATGG
ATGTGACCGAGCAGCGGGAACAGCTCTCTGCGCCCTCCCT
ACCCAGCATCACTTCTCTGGTTGGGGGATACGTTGGCGAG
TTTGACACCTACTCATGCCAGATCGCCACAGGAGCTGCTT
CTACCTGTGTGGGCAGCACCTCCGGGCAGCTGGACTCCTT
CAAGCTGGATGACCTCCAGGTGTATGGCTGCTACCCGGGC
ACGTTTGCTTTGAGCTACCTGGACGAGACGCTGTCCTCTT
CGGGTGGGTCAAACTGCTTTGGAAGTCCGGCATCTGCACC
GTCTCCCTCCACCCCGGGATACCAGCACATGTCTGCATGG
GACAGCACCTTTGGTCCCTGCTCTCCTGACGAGGGTTGCT
GGGGTTCTGAGAAGCCTCTGAACCAGGCAGCATCTTTCTT
CACATTTGGGCACGTCACGGCTGATGAGCTTTCCCCACTG
GGACAGATGCAGTCACAGATCCCAGATCAGGATCCCTTTT
CTCATACTCCGCAACATGGTTCTCCACTTCCCTTCAGTCC
ACTCAGCTTAGAGCAGGGCAGCCGGGATGGATCGGGACTG
ATGGACGGACACTTGTCTCCTAAAGTGAGGAGCCCCACAG
GAAATGAGGGACGCTGCGCCGTGTGCGGAGACAATGCTTC
TTGTCAGCATTACGGGGTGCGCACTTGTGAAGGATGCAAA
GGCTTTTTCAAGCGCACAGTACAGAAGAACGCCAAATATG
TTTGTCTCGCCAACAAAGACTGTCCAGTGGATAAAAGGCG
GAGAAACAGATGCCAGTTCTGCCGCTTCCAAAAGTGCCTA
GCTGTGGGGATGGTGAAGGAAGTTGTAAGAACAGACAGCC
TGAAAGGAAGAAGGGGGCGTCTGCCATCCAAACCCAAAGC
TGTTCAGGACTCAGTGTCTGTCTCTTCACCTGTGAACATC
ATCGCCTCTCTCGTTACTGCCCATATCGACTCAAACCCTG
CCAGTGCAAATCTGGACTATTCAAAGTATCAGGAATCAAC
ATCTGGATTGCCTGAGAAGGAAGATGCCAACGACATACAG
CAGTTTTATGACCTGCTAACAGGGTCAATGGATGTGATCA
GGAAGTGGGCTGGAAGCATCCCTGGATTCAGTGCCTTTTG
TAAGGAGGACCAAGAGCTTCTTCTGGAGTCAGCTTTTGTT
GAGCTCTTCATACTTCGTCTAGCTTACAGGTCAAACCCTG
AGACAGACAAACTTATTTTCTGCAATGGTGTGGTTTTGCA
CCGGACGCAGTGCGTACGAAGCTTTGGTGATTGGATTGAC
TCAATTATGGAGTTCTCTCAGAGTTTACATCGCTTGAATT
TGGACATATCTGCTTTTTCCTGTCTTGCCACACTGGTCAT
AATCACAGATCGACATGGCCTGAAAGAGCCCAAACGGATC
GAAGACTTCCAAAACCGTTTGATCACATGTCTCAGAGACC
ACGTCTCCACAAGTGCCCTTGAGGTCGGCCGGCCCAACTC
TCTGTCCCGACTGCTGAGCAAGCTCCCAGAGCTGAGAACA
CTGTGCACCCAAGGCCTCCAGCGAATCTTCTATCTCAAAC
TGGAAGACTTGGTCCCACCTCCACCCATTGTGGATAAAAT
CTTCATGGACACGTTGCCATTCTGAATGTGACTTTATAAA
TGGACAACCAGGGTGATGAACTGAGGATATGGGATGTTTG
GGGAGCTCTTAAGGGTCTGACTAGTCAAAGGACTTTATCG
CTTACGGTTTCTCTGCTTTCTTGGAAAGGGAGTCAGAGAA
GGATGACATTCTACTTAACGCCTGTGTTTGAAGACCTTCA
TCGCATCGTCTTCAACACTGAACCTACTAAGTGACTGTAT
GCATTCAATAGACATGTCATTATCAGACATGGACTTTCAA
ATCTTAGTGTGTTTCAAGCTGAAATGGTGGCTTTAGTCGG
TAACATTTCAGGTCAATGGTGCAAATCAAATGCTCTACAT
GTGTGACTTCTGAAAGAAATGATATTCCCATCAGTATTAC
ACCAATGTTCAGAGAGCATATTCCAGATGAACAGCATCCA
AAGATCCATCTTCAAGAAAGAAAGGCCATGGACCAAAACA
AGGAGTAGAAACAGCATTTATTTGGATGCTTAAATGATCA
GACAAAGCCTTAAATACATTCAAGTGCCGAAGCATTATCT
ATCTTAAAGGGGCTATATGTAGAATCCAGAATCTAAGGCC
ACTGGCTTTTTAATTAACCAGTCATCGTCTTATTCACAAC
ACAAAATAGACAACCTAGGTCTCATTTTCAAGTTTTATTA
CAAGATTAATACATCCAGTCCCTTTAAAAACGCTCAAAAA
TGTGCTCAAACAGAAAAACACTCAAACACTTGAGAACAGG
ATTGATGTGAATGCATTCGGGTTGACTTTGCTAATGTTTC
TAGAAACATAAGCGTGTATTTTAACAGTGATTAGTTCATA
TAAAAGGTGGTGTGAGATCCAGTGCAGCTACTGTACATGT
ACAGCCTCGTACACATGCAAATACTTGGAGTATTACAGAT
GCCTGGCTTAGTGTGCGGTACCAGTCAGACTATAGAAGAA
TCATATTTGTATGTATGTATTTTGAGGATGTAAATGTTTG
TTTAGAGCTTCTGCAGACTATTTTTTTTCCGCATATTGAA
AATCAAGATCGGGCATTCTCAGTTTTTTATATATATAAAA
TGAGAGGTATTGCTTATCTTTCATTCATTTTGTGCAGCTC
TATATGGAATAAATTTGAAACTAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations