Transcript

thraa-003

ID
ZDB-TSCRIPT-120213-970
Name
thraa-003
Previous Names
  • thra-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053626 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053626|OTTDARG00000002255|ZDB-GENE-990415-263 thraa|no_translation thra-003 LG_ AL590145.3 Danio rerio protein_coding KNOWN, 651 bp
AGATCATTACGCCTGCCATCACACGAGTTGTGGACTTTGC
CAAAAAACTGCCCATGTTCTCCGAGCTGCCCTGTGAAGAC
CAGATCATCTTGCTGAAAGGCTGCTGTATGGAGATCATGT
CATTGCGAGCAGCGGTGCGCTACGACCCAGAGAGCGAGAC
TCTGACCCTGAGCGGAGAGATGGCCGTCAGTCGAGAGCAG
CTGAAAAACGGAGGGCTCGGAGTGGTTTCTGATGCCATCT
TTGATTTGGGGAAGAGCCTGTCACAGTTTAACCTGGATGA
CTCTGAGGTGGCACTGCTACAAGCTGTGCTGCTCATGAGC
TCAGATCGCTCTGGACTGACATGTGTGGAGAAGATCGAGA
AGTGTCAGGAGATGTACCTGTTGGCATTCGAGCACTACAT
CAACCACCGCAAGCACAACATCTCCCACTTCTGGCCCAAG
CTGCTGATGAAGGTGACGAACCTGCGCATGATCGGCGCCT
GCCACGCCAGCCGCTTCCTGCACATGAAGGTGGAGTGTCC
AACAGAACTGTTCCCGCCGCTCTTCCTGGAGGTCTTCGAG
GATCAGGAGGTGTGACCCAGAGACACAGCGGCAAAACAAA
CTCCACCTCATTTTGTTTTCTCGCAAAGCATACCAGAAGC
GTTTTTTGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations