Transcript

thraa-201

ID
ZDB-TSCRIPT-090929-212
Name
thraa-201
Previous Names
  • thraa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002440 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002440|OTTDARG00000002255|ZDB-GENE-990415-263 thraa|OTTDARP00000002163 thra-001 LG_ AL590145.3 Danio rerio protein_coding KNOWN, 2292 bp
CGCATACTTCTATACCATCAGCTCGTCCTTACCGTAAAGG
GGGTGGAGCGACTATAGTAAAGCTCGTGTATTTTCCTGTT
GTGGCAGCCGAAACCGAATCGTTTTCAAACGTGGTCAAAC
AAATAACATACTAACACTTTCCTTCTAAGTGGATATAATC
CGAACATAGGCTATTATTTTAAGTAGTTCTTAGCGGTTTG
GAAGGGTATCGCAGCGCGCCGAGCGGGCGACTCGCGACGA
AGAAGACCGCTCGTTAAGGAGACTGCTGGTGGGACTTCAA
TGTACCATTTCGCGTTGTTTTGGAAGCAGTTTGTGTTTCT
TCGTAAGGAAGTGGCATTGGCGTCCTGTAACTGCTGAATG
AGCGACCGTGAGCTGATCGTATGCTGACGTGCAGAGGGTC
GAGTCCGCCTCAGTCTGCTGTGATTGGATGCTGGATGGAA
TCAAGGTGAATGGAAAACACAGAGCAGGAGCACAACCTGC
CAGAAGGAGATGAGACGCAATGGCCAAATGGAGTGAAGAG
GAAAAGAAAGAATAGTCAATGCTCTATGAACAGCACATCC
GACAAGAGCATCTCTGTTCCTGGGTACGTTCCCAGTTATC
TGGAGAAAGATGAGCCGTGTGTGGTGTGCGGAGACAAGGC
CACTGGCTATCATTACCGCTGCATCACATGTGAGGGCTGC
AAGGGTTTCTTCAGGAGGACAATACAGAAAAACCTTCATC
CGTCCTATTCCTGTAAATATGACAGCTGCTGCATCATTGA
CAAAATCACCCGCAACCAGTGCCAGCTGTGCCGCTTCAGG
AAGTGCATCTCAGTGGGCATGGCCATGGACTTGGTGCTGG
ATGATTCGAAGCGCGTGGCCAAGAGGCGTCTGATCGAAGA
AAATCGGGAGAAGAGAAAGAAAGAGGAGATTGTGAAGACG
TTACACAATCGACCTGAGCCCACCGTGTCAGAGTGGGAGC
TCATTCGTATGGTGACGGAGGCTCATCGGCACACCAATGC
CCAGGGCCCTCACTGGAAACAGAAACGCAAGTTCCTACCA
GAAGACATTGGACAGTCTCCAGCCCCGACATCAGACAATG
ATAAAGTGGACCTGGAGGCCTTCAGTGAGTTTACCAAGAT
CATTACGCCTGCCATCACACGAGTTGTGGACTTTGCCAAA
AAACTGCCCATGTTCTCCGAGCTGCCCTGTGAAGACCAGA
TCATCTTGCTGAAAGGCTGCTGTATGGAGATCATGTCATT
GCGAGCAGCGGTGCGCTACGACCCAGAGAGCGAGACTCTG
ACCCTGAGCGGAGAGATGGCCGTCAGTCGAGAGCAGCTGA
AAAACGGAGGGCTCGGAGTGGTTTCTGATGCCATCTTTGA
TTTGGGGAAGAGCCTGTCACAGTTTAACCTGGATGACTCT
GAGGTGGCACTGCTACAAGCTGTGCTGCTCATGAGCTCAG
ATCGCTCTGGACTGACATGTGTGGAGAAGATCGAGAAGTG
TCAGGAGATGTACCTGTTGGCATTCGAGCACTACATCAAC
CACCGCAAGCACAACATCTCCCACTTCTGGCCCAAGCTGC
TGATGAAGGTGACGAACCTGCGCATGATCGGCGCCTGCCA
CGCCAGCCGCTTCCTGCACATGAAGGTGGAGTGTCCAACA
GAACTGTTCCCGCCGCTCTTCCTGGAGGTCTTCGAGGATC
AGGAGGGAAGCACTGGAGTGGCAGCACAGGAAGACGGTTC
CTGCTTAAGGTGAACCTCGTTTCGGTCCCTCGCCTCCAAA
CCACATCCATTCACGTGCATCCCAAGAGGTTTACCTTGTT
CTGCTGCTTGCCCAAAATAAAAAGGACACAGCCAGACTCC
CCCGAAAGCATCTTTTGGAATAGTTTAACCCGCTGGTTCA
GATGCATAGCTGGGTTTCAGCGTCCTTTTTGACCGATATT
GTGTCATTATGGCTCCAGGAGTTCGGGACGTGGTCTCCAT
TTAAAGTGACACAGAGGAACAAAAGGGCAAAAAGGACAAA
CTCACTGTGACTCGCTAATCTCAGGCTCAATGCAACCCAC
CAGCACTGCAGACACACACTGCCCACAGACGCAATCTACA
GCACCAGCACGGGGAATCAGGAAGACCTCTATTTTTTTTT
CTCTCTCTCTGGACGTACAGTACAGAACTGGTTTACAGCA
GCACTTTTATTAGAACAGAACATTCAGTTCTTTACACTTA
GCCAGATGATGAATATGTTGATTGAGAAGTTGGCTCTAAA
ATGGGTCATATTATAATGTTTTGAAATAAAAGTGCATTGT
GCTATGAAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations