Transcript

carm1-203

ID
ZDB-TSCRIPT-120213-961
Name
carm1-203
Previous Names
  • carm-002
  • carm1-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053589 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053589|OTTDARG00000004595|ZDB-GENE-040724-77 carm1|OTTDARP00000042149 carm-002 LG_ BX649502.4 Danio rerio protein_coding KNOWN, 827 bp
GGCAGGGGACACAATGTCAGGCACTGCACTTTTAATCGCC
AACAAGAGACAAAGCTACGATATTAGTATTGTTGCTCAAG
TGGATCAGACAGGCTCCAAATCCAGTAATCTACTTGATCT
CAAGAACCCTTTCTTCCGGGATGCCTACAGCCTATGACCT
CAGTACTGTCATTGGTGGCAGTGGGACAACCGTGTCCCAC
AACAATCTCATCCCCCTTGGTACAGACACGCATGCACTGA
ACACGGGGATCGTGAACCACACTCACTCCAGAATGGGCTC
TATAATGAGCACAGGAATCGTCCAGGGGGCAACAACTGCG
CAGCAGGGTCCAAGCAGCGCCAGTCTTCATTACCCCGTCA
CCAACCAGTTCACCATGGGCGGCCCGGCGATCTCCATGGC
ATCTCCAATGGCCATCCCCAGCAACACCATGCACTACGGG
AGCTAAGGCTGAGGGGACGGCCTCTGCATGTCCGATTCTC
CAAACGTCCCCTTTACCCCCCCTGCAAACCAACAGCCAAA
TTCAGAAAACCAAAACCAGTGCACCAGTCTCTGACCATCA
CTTTATACTCTCTCTCTGTCTCTACATATATATATATATA
GATATACATGTATACTTATATGTATATATTCTAAAATTTC
TTTCACTGGCGTTTTATTCTTACATATCCGTCCCGCGGCC
CTATAATGTTAGCGTGCGCAGGCATTTGGCCAGTTCAACG
TGCCTGAGTTGTCACTGTTACTCACAAATCCCCCTCCTCC
AAAGCCACATGCAGCGCCTGCTCCACAACCAGCCACTAGG
AGGCAGCACTTGTCTGTAAGCATGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations