Transcript

carm1-201

ID
ZDB-TSCRIPT-090929-389
Name
carm1-201
Previous Names
  • carm1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004907 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004907|OTTDARG00000004595|ZDB-GENE-040724-77 carm1|OTTDARP00000004453 carm-001 LG_ BX649502.4 Danio rerio protein_coding KNOWN, 3334 bp
GAAGATGGCGGTGTCCGTGTTCTCAGGCGTGCGCCTCCTC
TCCATCGGAGACGCCAATGGAGACATCCAGCGGCATTCAG
AGCAGCAGCCTCTGCGACTGGAGATCAAGATGAACCAGGA
CGCGGCTCAAATCATCCTCTCGAACAATGAGGAGACGTGT
GTCTTTAAGTGTACAGTATTGCGGGAGACAGAGTGCAGTC
GTGTCGGGAAGCAGTCCTTCATCATAACTCTAGGCTGTAA
CAGTGTCCTCTTGCAGTTTGCATCTCCAGCAGATTTCTCG
TCGTTCTATAACCTCTTGAAAATTTGTCGTGGACAAAAAG
GCGACCGTTCAGTCTTTAGTGACAGGACAGAGGAGTCTTC
AGCTGTACAGTATTTTCAGTTTTATGGGTATCTCTCTCAG
CAACAAAACATGATGCAGGATTATGTACGAACTGGAACAT
ATCAACGAGCCATCCTCCAGAATCATACTGACTTCAAGGA
TAAAGTGGTGCTGGATGTAGGTTGTGGCTCTGGCATTCTC
TCATTTTTTGCAGCTCAAGCTGGTGCCCGTAAAGTTTATG
CTGTGGAGGCCAGCACCATGGCTCAACATGCAGAGGTTCT
TGTAAACAGTAACAGGCTGTCAGAGCGTGTTGTGGTGATT
CCTGGGAAAGTGGAGGAAGTGTCTTTACCTGAGCAGGTGG
ACATTATCATATCCGAACCCATGGGCTACATGCTGTTCAA
TGAAAGGATGCTGGAGAGTTACCTACACGCCAAGAAATTC
CTCAAGCCCAGTGGCAAAATGTTTCCCACCATTGGAGACG
TTCACCTCGCTCCGTTCACAGATGAGCAGCTTTACATGGA
GCAGTTTACAAAGGCCAATTTTTGGTACCAGCCGTCTTTT
CACGGAGTGGATTTGTCTGCGCTGAGAGGAGCTGCAGTAG
ATGAATACTTCAGACAGCCTATTGTGGACACTTTTGATAT
CAGGATCCTGATGGCTAAATCTGTCAAATACACAGTCAAC
TTTTTAGAAGCTAAAGAAGAGGATCTTTACAAGATAGAAA
TCCCCTTCAAATTCCACATGATGCATTCAGGGCTTGTACA
TGGGCTGGCATTCTGGTTTGATGTTGCATTCATAGGATCA
GTGATGACGGTGTGGCTCTCGACGGCCCCCACAGAGCCCC
TCACTCACTGGTACCAAGTGCGCTGTCTGCTGCAGTCACC
TCTCTTTGCCAAGGCAGGGGACACAATGTCAGGCACTGCA
CTTTTAATCGCCAACAAGAGACAAAGCTACGATATTAGTA
TTGTTGCTCAAGTGGATCAGACAGGCTCCAAATCCAGTAA
TCTACTTGATCTCAAGAACCCTTTCTTCCGGTACACGGGC
ACAACACCTGCCCCTCCTCCAGGTTCACATTATAGCTCTC
CCTCAGAGAACATGTGGAACACTGGGGGAACATACAGCAT
GAGCCAAGGCATGGCTGTGTCAGGGATGCCTACAGCCTAT
GACCTCAGTACTGTCATTGGTGGCAGTGGGACAACCGTGT
CCCACAACAATCTCATCCCCCTTGGTACAGACACGCATGC
ACTGAACACGGGGATCGTGAACCACACTCACTCCAGAATG
GGCTCTATAATGAGCACAGGAATCGTCCAGGGGGCAACAA
CTGCGCAGCAGGGTCCAAGCAGCGCCAGTCTTCATTACCC
CGTCACCAACCAGTTCACCATGGGCGGCCCGGCGATCTCC
ATGGCATCTCCAATGGCCATCCCCAGCAACACCATGCACT
ACGGGAGCTAAGGCTGAGGGGACGGCCTCTGCATGTCCGA
TTCTCCAAACGTCCCCTTTACCCCCCCTGCAAACCAACAG
CCAAATTCAGAAAACCAAAACCAGTGCACCAGTCTCTGAC
CATCACTTTATACTCTCTCTCTGTCTCTACATATATATAT
ATATAGATATACATGTATACTTATATGTATATATTCTAAA
ATTTCTTTCACTGGCGTTTTATTCTTACATATCCGTCCCG
CGGCCCTATAATGTTAGCGTGCGCAGGCATTTGGCCAGTT
CAACGTGCCTGAGTTGTCACTGTTACTCACAAATCCCCCT
CCTCCAAAGCCACATGCAGCGCCTGCTCCACAACCAGCCA
CTAGGAGGCAGCACTTGTCTGTAAGCATGCTGAAAAAGCA
CAAACCAGAGACTCAAGACTCAACTCAAAGGACTCGGTCA
GAACGCTAACGATGGGACACTTTTGTTTTTTCTTTTCTTT
TTAAATAAATGCTTTACAAATGTGCACGCCCCCTCCCACC
CTTCATGAACTCCCACTTTTTTAGCTTCACAAACTCCATC
ATTGACTCTTAATATGAATTTGAGTTTCGAGGATCTTCAT
CGTACCTTCACTTCACCGTTGGCTTTTTAACGTTTCCAGC
AACATGGACAGGCCGTCGCATATCAACTTCTCTCAGCATG
GGCTTTCGGCGGCCATCTTGAGTTGACCTAAATGTTCGTC
CAGGCCTCTCGAGAAAGAGACGGACACGTGCTGTAGATGC
TCGCAGACTTCATTACGACTACTAGCGCAGTACCGCTGGA
TCCTGCCTGTAGACAACCATAGCGTAGATAGAGATCGTCT
TTCTTTCCATTCCATTTCTGACTGTGTGTTTTAATGTAGT
GCAGTTGACGTGTGTCGCTTGGTGTTCCCCGAGGTGAATT
CTGAGCATGGTTTAATCGAGACTCCAACACCACGCAAATC
TGACTTCATCATTTGGCAGATTCGCTGACAATTATATGGA
CACAAATGGTTTAGGAATACAAAGACCAGCACCAAACCCT
TCACTACCAGCCAGGGAAGGAGGGTAGATGCTGGGATGGA
CAGTCAGCACTGGGGGGGGAGGAAGATTGATGCATGAATG
ATAAAATAAAAATAAAAAAACAGTTAGGTCTGTGGACACA
CGCACACACTGACCACAGCAGCAGGACAACTGTTTGGGAA
TTGCAGTATCCTAGTTTACGCCCCCGCCCCCCCCAGTAAA
CCCTTATCTGAACTTCTGTGTGTTGTGAGACTCGTTGAGG
AAAGGAGGAGATGAAGTGACGCCTGAGCAGCTCCAGCTTT
CCTCCTTTCACTCCTTCACTGGGGATTTGACCATTACCCC
ATCCAAGACTCTGAAGTCGTATGCACCGCTTCCACTCAAT
TTTTTTGGTTTTGTTTTGGGGTTCATTTGGTTTGATTTAG
CAAGGATCATGAGATGGAAAAACAACCTTGTCTGGTAGTT
TGTAGAGTTAACTTTTTGTTTCGTTTTTTTGTTTTCTTTC
ACAAAAAAAGCAACAGACAAAAAAAGGAGCATATTAAATG
TTGATGGAGAAGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations