Transcript

carm1-202

ID
ZDB-TSCRIPT-120213-575
Name
carm1-202
Previous Names
  • carm-003
  • carm1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053588 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053588|OTTDARG00000004595|ZDB-GENE-040724-77 carm1|OTTDARP00000042148 carm-003 LG_ BX649502.4 Danio rerio protein_coding KNOWN, 842 bp
GGCTAAATCTGTCAAATACACAGTCAACTTTTTAGAAGCT
AAAGAAGAGGATCTTTACAAGATAGAAATCCCCTTCAAAT
TCCACATGATGCATTCAGGGCTTGTACATGGGCTGGCATT
CTGGTTTGATGTTGCATTCATAGGATCAGTGATGACGGTG
TGGCTCTCGACGGCCCCCACAGAGCCCCTCACTCACTGGT
ACCAAGTGCGCTGTCTGCTGCAGTCACCTCTCTTTGCCAA
GGCAGGGGACACAATGTCAGGCACTGCACTTTTAATCGCC
AACAAGAGACAAAGCTACGATATTAGTATTGTTGCTCAAG
TGGATCAGACAGGCTCCAAATCCAGTAATCTACTTGATCT
CAAGAACCCTTTCTTCCGGTACACGGGCACAACACCTGCC
CCTCCTCCAGGTTCACATTATAGCTCTCCCTCAGAGAACA
TGTGGAACACTGGGGGAACATACAGCATGAGCCAAGGCAT
GGCTGTGTCAGGGATGCCTACAGCCTATGACCTCAGTACT
GTCATTGGTGGCAGTGGGACAACCGTGTCCCACAACAATC
TCATCCCCCTTGTGAACACGGGGATCGTGAACCACACTCA
CTCCAGAATGGGCTCTATAATGAGCACAGGAATCGTCCAG
GGGGCAACAACTGCGCAGCAGGGTCCAAGCAGCGCCAGTC
TTCATTACCCCGTCACCAACCAGTTCACCATGGGCGGCCC
GGCGATCTCCATGGCATCTCCAATGGCCATCCCCAGCAAC
ACCATGCACTACGGGAGCTAAGGCTGAGGGGACGGCCTCT
GCATGTCCGATTCTCCAAACGTCCCCTTTACCCCCCCTGC
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations