Transcript

mitfa-202

ID
ZDB-TSCRIPT-120213-385
Name
mitfa-202
Previous Names
  • mitfa-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055017 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055017|OTTDARG00000019915|ZDB-GENE-990910-11 mitfa|OTTDARP00000043154 mitfa-003 LG_ BX927362.10 Danio rerio protein_coding KNOWN, 636 bp
TCTTACAGACCTTTTCTGCTTCTGTATCTTATGGAAAAGG
AGTTTATAAAGGTTTGATAACAAGCATGTTCATGGGCCAA
TGACATGACCACATTGAAATGGTCTACATGAACAGAACCA
TTCCTCTGAGATGATGGCGTGTGGATCATCTGCTGGACTA
TTTGTTTTTGTGAGACATAATGTTCGAAATGATGCCAGGA
AAAAAATCTTGAGAAAAAACAAGCACCACATCATCTGAAG
ATCTTCATGCTAGAAGGATCCCAACACTAGATGATGGAAT
TACCATTGATGCACTGAAGGTCCGAGTTGACTACACAAGC
AGATAGTGAGAATCTCTTGAACAGAGGCACAGAGTGGTTT
CATTGGCGGCAAAAATGGCCCTTCTGATAGAAAGGAACTA
GCTGAAAGGATCTGGTTCAGACCCACCTGGAAACCCCCTC
GAAGTACCACATCCAGCAGAGCCAGAGGCAGCAGGTGAAG
CACTACCTGTCCAGTGCACTAGGAGCCAAGCTGAGCCCAC
AGGCCAGCACAGGGCCCGGCCCCAGCCAGCCCGCCGAGCA
CGGCATGACCCCGGGACCCGGAGCCAGCGCTCCCAACAGC
CCTATGGCCCTTCTCACCCTCAACTGTGAGAAAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations