Transcript

mitfa-201

ID
ZDB-TSCRIPT-090929-7490
Name
mitfa-201
Previous Names
  • mitfa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024671 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024671|OTTDARG00000019915|ZDB-GENE-990910-11 mitfa|OTTDARP00000020348 mitfa-001 LG_ BX927362.10 Danio rerio protein_coding KNOWN, 1652 bp
GAAGAGCAATCCCCTCCCACCCCCTTAAATACATTTTGTG
TCTTTTCTTTGGCATTGACATCTTCAGCTGGCCAAGACGA
CTGGTCAGTTCTTGCACATCACCTAAATTCACAAAGGGAA
TACTTTTTTGAAGCTAACACATAGTTGAACATGTTGGAGA
TGCTCGAGTACAGTCACTACCAGGTTCAGACCCACCTGGA
AACCCCCTCGAAGTACCACATCCAGCAGAGCCAGAGGCAG
CAGGTGAAGCACTACCTGTCCAGTGCACTAGGAGCCAAGC
TGAGCCCACAGGCCAGCACAGGGCCCGGCCCCAGCCAGCC
CGCCGAGCACGGCATGACCCCGGGACCCGGAGCCAGCGCT
CCCAACAGCCCTATGGCCCTTCTCACCCTCAACTGTGAGA
AAGAGATGGACGATGTAATTGAAGACATTATAAGTTTGGA
ATCAAGCTACAGTGATGACATTCTTGGGTTCATGGATGCA
GGACTTCAAATGACAAACACGATTCCAGTTTCAGCAAACC
TGCTGGACATGTACAGCAATCATGCTCTTCCTCCAGCTGG
AGTTTCCATCAGTAACTCCTGCCCCTCAAGCCTGCCGGCC
GTCAAAAGGGAATTATCCGTTACTCCATCTCCGGGCATGA
TGCACATAATGGACAAAGCTGGACCATGTGGCAAGTTTGA
CTCTTATCAAAGACCTGATGGCTTTCCAGTAGAAGCAGAA
GTCAGAGCCCTGGCAAAAGAGAGACAAAAGAAGGACAACC
ACAACCTCATTGAACGAAGAAGGCGGTTTAATATCAATGA
CAGAATTAAGGAGCTGGGGACTTTAATTCCCAAGTCAAAT
GATCCAGACATGAGGTGGAATAAAGGCACCATCCTGAAAG
CATCAGTGGATTACATTAGGAAATTGCAGAAAGAGCAGCA
GAAAGCAAAAGAGCTGGAAAACAGACAGAAGAGACTAGAA
CACGCAAACAGACATCTCCTGCTCCGTATTCAGGAACTTG
AAATGCAAGCCCGTGCTCATGGACTCACCGTTGTAGCTTC
TTCCAGCCTTTATTCCGCTGAGTTAGTGGCTCGAGCAATC
AAACAAGAGCCTGGGATGGGGGACTGCACATCCAATTTGT
ACCCACACCTTCCCAGTCCTGACATGTCCCGTCCTACCAC
TCTGGACCTCAACAACGGCACCATCAGCTACAATGACAGT
CCCACGGAGGACGGCGAGCCGGGGGTCTACGACAGCCCAA
ACAAGGCCTCCACCAAGCTGGAGGACATGCTTATGGACAA
CACCCTGTCTCCGGTGGGCAGCAGCGACCCGCTGTTGTCC
TCCGGATCCCCAGTACCTTCCAACAGTAGCGGCAGCAGCA
GTATGGACGAACATGACAATGGCTGTTAGCAATGCCAACT
AAATTTCATGAACCAAAGTTAGACAATTAGATTTGTGTGT
GTGTGTGTCTTGTAAGTACCAGTGTTACATCCAGATCATG
AAGAGCGCAATTTCGTAAAGTATTAATCTTGTATTTCAGA
ATATTTAGTGTGCTTGTGTATATATTTTTTCATTTATCAT
GTCAGAGTCTAGTCAAGAATGAAATCGTGTAAACAATTAG
TTGATTTTTGAAGGATTCTCGCGGATGATATAAAGAGTAG
CTTGAATAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations