Transcript

thrb-203

ID
ZDB-TSCRIPT-120213-231
Name
thrb-203
Previous Names
  • thrb-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053757 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053757|OTTDARG00000014243|ZDB-GENE-990415-268 thrb|OTTDARP00000042258 thrb-003 LG_none BX927163.32,CU207349.4,CR382334.8 Danio rerio protein_coding KNOWN, 3136 bp
CTTCGGGTCCATGTTGGAGTTGATCTGCTCTGCTGGGTCA
TTTCAGGCCACGTATGTCCGATCACAGGAGCAAACATTAA
AGTTACAGAGATATCAATGAAGGACATACACACATGCTGT
GTTGCAGCTTCGAGGGTCTCTCATCTGAATGAATGCATTG
CCCATGAAGTCAGCGATGGGGCGTTGCAAGAGGGGCTCTG
GCTCTTATGACATGGTTTAGAGGATGAAAGGCAGGATGTA
AGGCTCTGCTTCTTCATACCACTCTGGGACAACTTCAAAA
TCACAAAGCACGAGATATCAGCGAGTCTGTGGACAACAAA
AGAATGATGGTTAAGGCCTAATATACTGCAGTATGTCAGA
GCAAGCAGACAAATGCAACTCCCGCTGGAAAGATGAGGCC
ATGCAGAATGGGTACATACCAAGTTACCTGGACAAGGATG
AGCTGTGTGTTGTTTGTGGAGACAAAGCAACTGGTTATCA
CTATCGCTGCATTACATGTGAGGGCTGCAAAGGTTTCTTT
CGACGCACAATTCAGAAGAACTTAAACCCAACATACGCAT
GCAAGTATGAAGGAAAGTGTGTCATTGACAAAGTTACCCG
AAACCAGTGCCAAGAATGTCGCTTCAAGAAATGCATCGCT
GTTGGCATGGCTACAGACTTGGTATTGGATGACAGTAAAC
GTTTAGCCAAGCGGAAGCTGATTGAGGAGAACCGTGAACG
CCGACGGCGTGAGGAGCTGCAGAAGACTGTATGGGATCGA
CCAGAGCCCACACAGGAAGAGTGGGAGATGATACGGGTTG
TCACAGAGGCCCATATGGCCACAAATGCCCAAGGCAACCA
CTGGAAACAAAAGCGCAAATTCCTGAGTGCAGTGGGGGTG
AAGGAAGCCAAGCCAGAAGACATTGGATCGGCACCTATTG
TCAATGCACCAGAGGGGAACAAAGTGGACATTGAAGCCTT
CAGTCAGTTTACAAAAATTATCACCCCCGCCATCACTCGT
GTCGTGGATTTTGCCAAAAAGCTACCCATGTTCTGTGAGC
TGCCTTGTGAGGACCAGATCATTTTGCTGAAGGGTTGTTG
CATGGAGATCATGTCTCTTCGAGCAGCAGTGCGTTATGAC
CCCGAGAGCGATACTCTGACGCTAAACGGGGAGATGGCTG
TCACACGGGGCCAGCTCAAGAATGGGGGTTTGGGTGTTGT
CTCAGATGCCATCTTTGATCTGGGTGTCTCGCTGTCCTCT
TTTAACTTGGACGATTCAGAGGTGGCGTTGTTACAAGCCG
TGATTCTGCTTTCCTCTGATCGTCCAGGTTTAACAAGCGT
TGAGCGGATAGAGCGTTGTCAGGAGGAGTTTCTTTTGGCC
TTTGAACATTACATCAACTACCGTAAGCACAAGGTGGCTC
ACTTTTGGCCCAAACTGCTGATGAAGGTGACAGACCTGCG
CATGATTGGTGCCTGCCATGCCAGCCGCTTCCTGCACATG
AAGGTGGAATGTCCCACAGAGCTCTTTCCGCCCCTCTTCC
TGGAAGTGTTTGAAGACTGATGGCAATCCAATCAGGCCAA
GCTGCTCCCACCAACACCAACCTCCACAAATCAGACCTCT
ACAGTCTCCCTGTTCCTGGTCATATGTTTCTAGCACTACT
GAACATCATTTCATTCCATAGAGTTAGGAGTAGCTCTGGG
GCCTATTTGATGGGATCCATTCCTTTTACAAAGCGGGTAC
ATTTGAATAGCATAAAAAAATAAATTCTGTTACTATTGTT
TTGTTTTTTCAGAAATGTTTGATATCTGGTCATAGTGTTG
GATACCGCTCAACAGAAATGTATGAACTATGCATTCAGGT
TTCATGTCACATCAGGCCTCAGAAATAAGTCAAATAGCGC
CACACTGCAAAGGATAATAGCAATATTTTGTTTCAATTTA
CGTCCTTATTCTATTGGTCTATAGGTCTTTTTAAGCTTAT
GTTAAGCTATAGGTTGTTTATTGTTTTGTTCCAGAACCCT
GTAAAGCACTTACAGTACCTAGACCGAATTTCATTACATC
AATAGGCGCAAAGTAAAATCACAATTGTGGGCTATATTAT
TACAATACTTTTGTCCTAGACAAAATCACTAAATGGAAAA
TGCATTTATACTTGTAACTTTAATTTGCATAGTTTAGGAG
CAGTACCACAAAAATAGATCTTAGACTCTTTATTGTCTCA
GGTTTGTCAGAATAACTCGGAAAGAAAAAATGAAAGGTCA
GTCAATTTCAGTATTATGTCTCAGAAAAAAAAAAGATCTG
AGCTGCCATAGGAGTTAGTTAGTTTTTAGCTGTGTACTCC
TATTTCTGCTTTGAAATTGTAGAGGAAAAATACACAGACA
AACTGCTAATTCCAAAGAGCAGCCTCAAAACATAAAACTG
TAATGTGAACAATCCCAAAATATAGTGCTAAGCAAGTAAT
GGCGAAAAGGATGTAAAAAAAGGTTTTCATGTATTCAATG
CCATGTATATTAAGTATTTGTGTGAGGGGTTTATTTGGAG
TGCTCAACATTGTCAGTTGTTTCTGTGCCATACAAATATC
AGGTTTCATTTCAATTAAGATTGGATGTTTAGATTAAAAG
ATGGCTGTGTAGGCGAGAACCTTAAAATAATTATTGTTTT
TAAGTGGCAGAAGGTGAACTAAAACTTGTAAATGACAAGA
TGGAATGTCCCTTTAAAATGTGGTTACAGCCCTAAGGCTT
TTTTTTTTTTTTCAGTACACCTGAAACCTTAATGGGCAAG
CAGACCTCAATATACTATAATATGCATTCAGAGAAAATTT
AGTTTAAAAATCTCCATATTTTATACATGGAAGTTTTTTT
TTTCTCTGAAGTCTTCAAAAACACAAATTGAAGCTCACAC
TGTAAAAAAAAATACCTGTAAATTATCAGTTTTTTGTATT
TTGTTATACGTGTTTATATTTTTTGTTTATTTTTGCATTA
TGGGAAAAGTTAACATTTTTGTTATAGTTTAAAGTGTTAT
ATTGTCTGGGTTGTGTTGTATATTTTGGTTTAATTTTCTG
TTATTTTACAGACTTATTTTTTTTATATAACATTTCTTAT
ACATTATATTATTTCAAACTACTAAAATGTTAATAAAAGT
CCCTTTGTTCATTTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations