Transcript

thrb-201

ID
ZDB-TSCRIPT-090929-3603
Name
thrb-201
Previous Names
  • thrb-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016999 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016999|OTTDARG00000014243|ZDB-GENE-990415-268 thrb|OTTDARP00000014411 thrb-001 LG_none BX927163.32,CU207349.4,CR382334.8 Danio rerio protein_coding KNOWN, 1992 bp
CTTCTTTCTGTGTCTTCGGGTCCATGTTGGAGTTGATCTG
CTCTGCTGGGTCATTTCAGGCCACGTATGTCCGATCACAG
GAGCAAACATTAAAGTTACAGAGATATCAATGAAGGACAT
ACACACATGCTGTGTTGCAGCTTCGAGGGTCTCTCATCTG
AATGAATGCATTGCCCATGAAGTCAGCGATGGGGCGTTGC
AAGAGGGGCTCTGGCTCTTATGACATGGTTTAGAGGATGA
AAGGCAGGATGTAAGGCTCTGCTTCTTCATACCACTCTGG
GACAACTTCAAAATCACAAAGCACGAGATATCAGCGAGTC
TGTGGACAACAAAAGAATGATGGTTAAGGCCTAATATACT
GCAGTATGTCAGAGCAAGCAGACAAATGCAACTCCCGCTG
GAAAGATGAGGCCATGCAGAATGGGTACATACCAAGTTAC
CTGGACAAGGATGAGCTGTGTGTTGTTTGTGGAGACAAAG
CAACTGGTTATCACTATCGCTGCATTACATGTGAGGGCTG
CAAAGGTTTCTTTCGACGCACAATTCAGAAGAACTTAAAC
CCAACATACGCATGCAAGTATGAAGGAAAGTGTGTCATTG
ACAAAGTTACCCGAAACCAGTGCCAAGAATGTCGCTTCAA
GAAATGCATCGCTGTTGGCATGGCTACAGACTCCAGAAGA
CATTGGATCGGCACCTATTGTCAATGCACCAGAGGGGAAC
AAAGTGGACATTGAAGCCTTCAGTCAGTTTACAAAAATTA
TCACCCCCGCCATCACTCGTGTCGTGGATTTTGCCAAAAA
GCTACCCATGTTCTGTGAGCTGCCTTGTGAGGACCAGATC
ATTTTGCTGAAGGGTTGTTGCATGGAGATCATGTCTCTTC
GAGCAGCAGTGCGTTATGACCCCGAGAGCGATACTCTGAC
GCTAAACGGGGAGATGGCTGTCACACGGGGCCAGCTCAAG
AATGGGGGTTTGGGTGTTGTCTCAGATGCCATCTTTGATC
TGGGTGTCTCGCTGTCCTCTTTTAACTTGGACGATTCAGA
GGTGGCGTTGTTACAAGCCGTGATTCTGCTTTCCTCTGAT
CGTCCAGGTTTAACAAGCGTTGAGCGGATAGAGCGTTGTC
AGGAGGAGTTTCTTTTGGCCTTTGAACATTACATCAACTA
CCGTAAGCACAAGGTGGCTCACTTTTGGCCCAAACTGCTG
ATGAAGGTGACAGACCTGCGCATGATTGGTGCCTGCCATG
CCAGCCGCTTCCTGCACATGAAGGTGGAATGTCCCACAGA
GCTCTTTCCGCCCCTCTTCCTGGAAGTGTTTGAAGACTGA
TGGCAATCCAATCAGGCCAAGCTGCTCCCACCAACACCAA
CCTCCACAAATCAGACCTCTACAGTCTCCCTGTTCCTGGT
CATATGTTTCTAGCACTACTGAACATCATTTCATTCCATA
GAGTTAGGAGTAGCTCTGGGGCCTATTTGATGGGATCCAT
TCCTTTTACAAAGCGGGTACATTTGAATAGCATAAAAAAA
TAAATTCTGTTACTATTGTTTTGTTTTTTCAGAAATGTTT
GATATCTGGTCATAGTGTTGGATACCGCTCAACAGAAATG
TATGAACTATGCATTCAGGTTTCATGTCACATCAGGCCTC
AGAAATAAGTCAAATAGCGCCACACTGCAAAGGATAATAG
CAATATTTTGTTTCAATTTACGTCCTTATTCTATTGGTCT
ATAGGTCTTTTTAAGCTTATGTTAAGCTATAGGTTGTTTA
TTGTTTTGTTCCAGAACCCTGTAAAGCACTTACAGTACCT
AGACCGAATTTCATTACATCAATAGGCGCAAAGTAAAATC
ACAATTGTGGGCTATATTATTACAATACTTTTGTCCTAGA
CAAAATCACTAAATGGAAAATGCATTTATACTTGTAACTT
TAATTTGCATAGTTTAGGAGCAGTACCACAAAAATAGATC
TTAGACTCTTTATTGTCTCAGGTTTGTCAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations