Transcript

vdrb-203

ID
ZDB-TSCRIPT-120213-1157
Name
vdrb-203
Previous Names
  • vdrb-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055072 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055072|OTTDARG00000034642|ZDB-GENE-080403-10 vdrb|OTTDARP00000043191 vdrb-002 LG_none CR847949.13,CR847966.5 Danio rerio protein_coding KNOWN, 371 bp
GGGCAGAAACTAATTTGATAGTGCTCTGTATGTTTCATAA
GTCCTGATGTTGATATAAAAATGTTTAAGCATTCAAACAC
TGGCGATATTCAGTGATGGAGTCAGCTGTCAGTACATCCA
CTCAAGTGCCAGATGAGTTCGACCGGAACGTTCCACGCAT
CTGTGGTGTGTGTGGAGACAAAGCTACTGGTTTTCACTTT
AATGCCATGACCTGTGAGGGCTGCAAAGGCTTCTTCAGGC
GCAGTATGAAGCGGAAGGCCAGTTTTACCTGTCCTTTTAA
TGGAAGCTGCACCATCACTAAAGATAACCGTCGCCACTGC
CAGGCCTGCAGACTCAAGCGTTGCCTAGATATTGGCATGA
TGAAAGAGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations