Transcript

vdrb-202

ID
ZDB-TSCRIPT-110325-2214
Name
vdrb-202
Previous Names
  • vdrb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049069 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049069|OTTDARG00000034642|ZDB-GENE-080403-10 vdrb|OTTDARP00000038505 vdrb-001 LG_none CR847949.13,CR847966.5 Danio rerio protein_coding KNOWN, 2033 bp
TTCAAAGTTTGTTTTGTGCCCGGAAACTGCGAGTCGCCCA
CTGGCCGCGGAAGAAGCGCGTTCAGATTCGACCGTGTGCA
TTGTTTGTGTGTACGTTACGTTAGTTAACCCACGGCGAGA
GAAAAAAAAATCCGCGCGGGATGGATTACAAAGCTGCGAT
AGCCAGCATAATTCGTTAGCATCTCGTCGACTAGCTCCTC
CAGAGGCTCGATCGCGAGTACGGGGCTGCGGTGCGGCTGG
ACGCGGAGCGAGGCGACCCTCTGCGGGCTGCGCTGCCGAG
GCGGTGGGCGTGTTTTCTCGGCGTGCTAGCATGTGAGCTG
GCGCCAAGTTCTCGGCGTGAAGAAAAAGAAAGAAAAAAAC
AAGATTTACAAGTTACGGATTGGAGAGAAGCAGCAAAAGT
CACATCACGCTTGATCGGAAAAGTTGCACGCAGTGATGGA
GTCAGCTGTCAGTACATCCACTCAAGTGCCAGATGAGTTC
GACCGGAACGTTCCACGCATCTGTGGTGTGTGTGGAGACA
AAGCTACTGGTTTTCACTTTAATGCCATGACCTGTGAGGG
CTGCAAAGGCTTCTTCAGGCGCAGTATGAAGCGGAAGGCC
AGTTTTACCTGTCCTTTTAATGGAAGCTGCACCATCACTA
AAGATAACCGTCGCCACTGCCAGGCCTGCAGACTCAAGCG
TTGCCTAGATATTGGCATGATGAAAGAGTTTATATTGACA
GATGAGGAAGTTCAGAGAAAGAAGGAGCTGATTCAAAGAA
GGAAGGATGAGGAGGCTCACAGGGAGGCGCAGAAGCCCCG
GCTTTCAGATGAGCAGCGCAACATCATTGACACACTGGTG
GACGCGCATCATAAAACATACGACGATTCCTACTCTGACT
TTTCACGCTTCAGACCTCCAGTTAGAGAGGGTCCAGTTAC
ACGCAGTGCCAGTCGAGCCGCGTCCCTCCATTCACTGTCA
GATGCCTCATCAGACTCCTTCAGCCACTCTCCAGAGTCAG
GCGATCGTAAGATGAATCTGAGTAACCTGCTGATGATGTA
CCAGGAGCAGGGCTTGAGCTCCAGTCCCGACTCAAAGGAG
GAGGATGGCTCCAGTCTCTCCATGCTTCCTCATCTGGCCG
ACCTGGTTTCTTACAGCATTCAAAAAGTCATTGGCTTTGC
CAAGATGATTCCTGGATTTAGAGAGCTGACGGCTGAAGAT
CAGATTGCTCTGCTGAAGTCCAGCGCTATAGAAGTGATCA
TGCTCCGATCCAACCAGTCCTTCAGTCTGGAGGATATGAG
CTGGAGCTGTGGAGGACCTGAGTTTAAATACTGCGTCAAT
GATGTTACCAAAGCTGGACACACTCTGGAGCTGCTGGAGC
CTCTGGTGAAATTTCAGGTGGGCTTAAAAAAGCTCAACCT
GCATGAAGAGGAACATGTGCTGCTCATGGCCATTTGCCTG
CTGTCTCCAGATCGGCCCGGGGTGCAGGATCACGTGCGAG
TGGAAGCGTTGCAGGACAAGGTATCTGAGGTTCTGCAGGC
CTACATCCGTGCACATCACCCGGGGGGGCGTCTGCTTTAC
GCTAAGATGATCCAGAAGCTGGCGGATCTCCGCAGCCTGA
ACGAAGAGCACTCCAAACAGTACCGCTCGCTTTCCTTCCA
GCCCGAGCACAGCATGCAGCTCACACCTCTGGTGCTGGAG
GTGTTCGGCGGGCAGGTCACCTAGCAAATTCACCCCCGTC
AGGAGAAGTGCTGCGGCTCAGACACACAGCGTGGAGTGGA
GTGAATGTATGGACAATCACCTTAAAACACATACAGAGTT
TCCAGGACGAAATTTGTGAGTGGTGTGTTAGTATGTATGG
GTGTGTGTCATTTACAGATCGCTTAGGGATTGCCATAGGT
GTTTCAGTTAGGTTTTTCGTGTTTTAGAAGGACATTCTTA
TGGGAGCTTGTTCTTGCCATGGAGTGTAAAAGAGAAAAGA
TTGTAGTGAGTTTTTATTTCACAATTCTCAATTCTTGTTT
TTTTTTTTTTTATTAAAAAGCAATTCTGGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations