Transcript

rpl13-203

ID
ZDB-TSCRIPT-110325-719
Name
rpl13-203
Previous Names
  • rpl13-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050342 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050342|OTTDARG00000035381|ZDB-GENE-031007-1 rpl13|OTTDARP00000039515 rpl13-002 LG_none CU651676.5,CU683900.5 Danio rerio protein_coding KNOWN, 658 bp
AGGACGGTATGTTCATTTATTCCAGCTAAACATGTAGTTT
ATCCGTATTAATCCTCAGTTCTAAGTTATCTTGCAATCAT
TTAAGTCATAAAACCTGAATCTGGTCGTAGTTTTATACCC
GTTACTGGCTGTATTGTTGAAGTTAGACAATGTTGAGAAA
AAATAAACGAGAGTGAACAACCATGGCTCCCAGCCGGAAT
GGCATGATTTTGAACCCTCACTTTCATAAAGACTGGCAGA
AGAGAGTGCGCACCTGGTTCAACCAGCCTGCCAGAAAGAT
CCGCAGACGTAAGGCCCGCCAGGCAAAGGCCCGTCGTATT
GCTCCAAGACCAGTTTCTGGACCTCTTCGGCCAGTAGTCA
GGTGTCCGACCATCCGCTACCACACCAAGGTCCGTGCCGG
ACGTGGCTTCACCTTGGAGGAGCTGAAGGCAGCTGGAATC
AACAAAAAGGTGGCCCGCACCATTGGCATCTCTGTTGACT
CACGCCGTCGCAACAGATCCACAGAGTCTCTGCAGGCCAA
TGTCCAGAGGCTGAAGGAATACCGCACCAAACTCATCATC
TTCCCCAGGAAGGCGGCTAAGCCCAAGAAGGGAGACAGTA
CTGAGGAGGAGCTCAAGATGGCAACACAGCTTACTGGACC
AGTCATGCCCATCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations