Transcript

rpl13-202

ID
ZDB-TSCRIPT-110325-2534
Name
rpl13-202
Previous Names
  • rpl13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050341 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050341|OTTDARG00000035381|ZDB-GENE-031007-1 rpl13|OTTDARP00000039514 rpl13-001 LG_none CU651676.5,CU683900.5 Danio rerio protein_coding KNOWN, 1383 bp
GCGTTGTCACTTCCTTTTCCCTTTCAGCCATTTTCCGCTA
AGGACGGAGTGAACAACCATGGCTCCCAGCCGGAATGGCA
TGATTTTGAACCCTCACTTTCATAAAGACTGGCAGAAGAG
AGTGCGCACCTGGTTCAACCAGCCTGCCAGAAAGATCCGC
AGACGTAAGGCCCGCCAGGCAAAGGCCCGTCGTATTGCTC
CAAGACCAGTTTCTGGACCTCTTCGGCCAGTAGTCAGGTG
TCCGACCATCCGCTACCACACCAAGGTCCGTGCCGGACGT
GGCTTCACCTTGGAGGAGCTGAAGGCAGCTGGAATCAACA
AAAAGGTGGCCCGCACCATTGGCATCTCTGTTGACTCACG
CCGTCGCAACAGATCCACAGAGTCTCTGCAGGCCAATGTC
CAGAGGCTGAAGGAATACCGCACCAAACTCATCATCTTCC
CCAGGAAGGCGGCTAAGCCCAAGAAGGGAGACAGTACTGA
GGAGGAGCTCAAGATGGCAACACAGCTTACTGGACCAGTC
ATGCCCATCAAAAAAGTGCACAAGAAAGAGAAGGCCCGCG
TGATCTCGGAGGACGAGAAGAACTTCAAGGCTTTCGCCAG
CCTGCGTATGGCCCGCGCCAATGCCCGTCTTTTCGGCATC
CGTGCCAAGAGGGCAAAGGAGGCCGCCGAGCAGGACGTCG
AGAAGAAGAAATAAACATTTGTATGGAACTGTCAAAAAAA
ATAAATGTCTTTAAAAAAAAATTCTGCTTTCCTGGAATCT
TTATTTTAATCTTAATACCATGGAAATTTGGCTAGTTTGT
AGAATATGCACTTATTTTTACTGATATGCCATGTTTTGAT
TTATTTAATGATGCATTTATTAGTTTTGGAAGCATTAAAG
TAACTATTTCGAGAAATAAGTATCTCTTAATGAAGTATCT
CTGGATTTGGACTTTGCAAGCAGTGCAGCGGGAAAACCAG
CAAAGTTTTTTTTTTTTTTTCCTCCCTCCCCCTTCAGGAT
TGCAGACATTATTGGTTTTGATTGTCACTGATGAAGTATA
AATGGTGTATTTTTTGTTTCTTCTAAATGTTATCTAGAGA
TGACACGCATACAGAGATGCAAATACAATATTCCCCAGAA
GATGGCAGCGTTTACCTTTTATGTTTGTTTCTTTTCTTGG
CAGGATTTTTATTTGTAGCTCATCGTTAGTGACATGTTTT
AAGCACGATCCAAAAATTAGTAGATTCTAGCTGGTTTATG
CTTCCGCAAATTAATTGAAAGGCACATGTGCGTGCTGGAG
ATTGCACTGTTCAAGCGGTCATTAGGTTCTGGGTCAGGAC
AGTTAAATTATTTCCCCAGACCTGTGCTAGTGAAACCAAT
TAAAGCAATATTCCACACCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations