Transcript

rpl13-003

ID
ZDB-TSCRIPT-110325-1627
Name
rpl13-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050343 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050343|OTTDARG00000035381|ZDB-GENE-031007-1 rpl13|no_translation rpl13-003 LG_none CU651676.5,CU683900.5 Danio rerio protein_coding KNOWN, 581 bp
ATTTTCGCATTAGGAGTGAACAACCATGGCTCCCAGCCGG
AATGGCATGATTTTGAACCCTCACTTTCATAAAGACTGGC
AGAAGAGAGTGCGCACCTGGTTCAACCAGCCTGCCAGAAA
GATCCGCAGGTAATAAGTGTGTCCACACATGTGTTGAAGG
TTTATGATGAGCATCACTTTATTTTAATTCATCTCATTTG
TACCTCAGACGTAAGGCCCGCCAGGCAAAGGCCCGTCGTA
TTGCTCCAAGACCAGTTTCTGGACCTCTTCGGCCAGTAGT
CAGGTGTCCGACCATCCGCTACCACACCAAGGTCCGTGCC
GGACGTGGCTTCACCTTGGAGGAGCTGAAGGCAGCTGGAA
TCAACAAAAAGGTGGCCCGCACCATTGGCATCTCTGTTGA
CTCACGCCGTCGCAACAGATCCACAGAGTCTCTGCAGGCC
AATGTCCAGAGGCTGAAGGAATACCGCACCAAACTCATCA
TCTTCCCCAGGAAGGCGGCTAAGCCCAAGAAGGGAGACAG
TACTGAGGAGGAGCTCAAGATGGCAACACAGCTTACTGGA
CCAGTCATGCCCATCAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations