Transcript

plk1-004

ID
ZDB-TSCRIPT-100915-751
Name
plk1-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046311 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046311|OTTDARG00000019450|ZDB-GENE-021115-7 plk1|no_translation plk1-004 LG_ BX004779.16 Danio rerio protein_coding KNOWN, 689 bp
ACAGAGGAAGCTGAAGACCCTGCTTGTATTCCTGTCTTCT
GGATTAGTAAATGGGTTGACTACTCTGACAAATATGGCCT
TGGTTACCAGTTGTCTGATAACAGTGTAGGTGTTCTGTTC
AATGATTCCACACGGTTGATCATGTGTGCTGACGGTGATA
GCCTGCAGTACATCGATCGCAACTCTCTAGAATCCTACCT
CAGTGTTCGCTCGTATCCCTCTGCACTCTCCAAAAAGATT
ACACTCCTTAAGTACTTCAGGAATTACATGAGTGAGCACT
TGCTGAAGGCTGGAGCGAATATAACTCCTCGGGAAGGGGA
TGAACTGACCCGATTGCCTTACCTTCGCCACTGGTTCCGC
ACAAAGAGTGCTATTGTGCTACACCTGAGTAATGGGACTG
TGCAAATCAATTTTTTCCAGGATCACACTAAGCTTATTTT
GTGTCCACTAATGGGAGCAGTGACGTACATCAATGAGAAG
CGAGAGTTTTACACCTACAAGATGACCTTAATCGAGGAGT
TCGGCTGCTGTAAAGAGTTGGCTAGCCGTTTGCGCTATGC
TCGCAACATGGTGGAGAAGCTCATGGCCTGCAAAAGCAGC
ACAACAGCTGCTACTTCAGCACGCTAACCCACTGACGTCA
TAAATTGTATAGCTATGAGTTCACCATCGGCTCTCACTTG
AGTCTGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations