Transcript

plk1-201

ID
ZDB-TSCRIPT-090929-6839
Name
plk1-201
Previous Names
  • plk1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023896 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023896|OTTDARG00000019450|ZDB-GENE-021115-7 plk1|OTTDARP00000019795 plk1-001 LG_ BX004779.16 Danio rerio protein_coding KNOWN, 2538 bp
GGCGGAGGCAACGAATCGAGCACAATTCAAAAAGTAGCAG
CGATTCACTGCATTCCCAACCGAGCTGCGGGCCGACGCGC
TTCACCACCGCCCGTTTACATCCACGAAATTCGACAAATG
CGGTGAATATACGGCGTTTAGATACTTTGTTGTGCCTTTT
TGTCTTGGCTGGCGGTATTATTTGAATGCGGATTTCAGCG
GAGGAGTGAAGTACTGCGTGTTGTTTACGGATAAAGGAGC
AGGAAACATCGCCTCGGTTGTTTATTTTTCAGGACGTTAG
GGTGTATTTTTGTACTTAAGAGCATTTGTAGTGTACAACG
ATGAGTGCTGCAATTGCAAAGCCATCGGCGAAGCCATCGG
CTCACGTCGATCCCAAATCTGCTCCTCTGAAAGAGATTCC
CGACGTTCTGGTGGATCCGAGAACCATGAAGAGATACATG
AGAGGTCGCTTTTTGGGAAAAGGAGGATTCGCCAAATGCT
ACGAAATCACAGATATGGACACAAAAGAGGTCTTCGCTGG
GAAAGTTGTGCCGAAGTCGATGCTGCTGAAGCCGCACCAG
AAGGAGAAAATGAGCACAGAAATCGCCATTCACAAAAGTC
TCGATAATCCGCATGTTGTGGGCTTTCACGGGTTCTTTGA
GGATGATGACTTCGTGTATGTGGTGCTGGAAATCTGTCGC
AGAAGGTCTCTCCTTGAATTGCACAAAAGGAGGAAGGCAG
TGACTGAGCCTGAGGCCCGATACTTCATGCGCCAGACTAT
TCAGGGTGTTCAGTACTTGCACAACAACAGAGTCATTCAC
CGTGATCTCAAACTTGGGAATCTGTTCCTCAATGATGACA
TGGATGTGAAGATCGGTGACTTTGGTTTAGCCACTAAGAT
TGAGTTTGATGGGGAGCGAAAGAAGACCCTTTGTGGCACT
CCAAACTACATTGCTCCTGAGGTGCTCTGCAAGAAAGGCC
ACAGCTTTGAAGTTGACATTTGGTCACTAGGATGCATTCT
ATACACACTGCTGGTTGGAAAGCCTCCATTTGAGACATCC
TGTCTGAAAGAGACCTACATTAGGATTAAGAAGAATGAGT
ACTCAGTTCCTAGACACATTAATCCAGTTGCATCTGCTTT
GATTCGTCGGATGCTGCACGCTGACCCTACACTCAGACCT
TCTGTAGCTGAACTGCTGACTGATGAGTTTTTCACCTCTG
GTTATGCACCCATGCGGCTGCCCACTTCCTGTCTCACTGT
TCCTCCCAGGTTCTCCATCGCCCCCTCCAGCCTGGATCCT
GCCCTCCTCCGCAAACCTCTCTCATCACTTAATAAAGGCA
CAGATAGTCCAATTGAGAAAATGGGGAAAATGGATCAGCC
ACAAAGAGAAGATCTGCAACAAAGAGATGGACCAGAGCAG
CCTGACACTCACCTAACTGACATGCTGCAGCAGCTGGCTG
TCGTCAATGCAGCCAAGCCGTCTGATAGAGACTTTATTAG
ACAAGAGGAAGCTGAAGACCCTGCTTGTATTCCTGTCTTC
TGGATTAGTAAATGGGTTGACTACTCTGACAAATATGGCC
TTGGTTACCAGTTGTCTGATAACAGTGTAGGTGTTCTGTT
CAATGATTCCACACGGTTGATCATGTGTGCTGACGGTGAT
AGCCTGCAGTACATCGATCGCAACTCTCTAGAATCCTACC
TCAGTGTTCGCTCGTATCCCTCTGCACTCTCCAAAAAGAT
TACACTCCTTAAGTACTTCAGGAATTACATGAGTGAGCAC
TTGCTGAAGGCTGGAGCGAATATAACTCCTCGGGAAGGGG
ATGAACTGACCCGATTGCCTTACCTTCGCCACTGGTTCCG
CACAAAGAGTGCTATTGTGCTACACCTGAGTAATGGGACT
GTGCAAATCAATTTTTTCCAGGATCACACTAAGCTTATTT
TGTGTCCACTAATGGGAGCAGTGACGTACATCAATGAGAA
GCGAGAGTTTTACACCTACAAGATGACCTTAATCGAGGAG
TTCGGCTGCTGTAAAGAGTTGGCTAGCCGTTTGCGCTATG
CTCGCAACATGGTGGAGAAGCTCATGGCCTGCAAAAGCAG
CACAACAGCTGCTACTTCAGCACGCTAACCCACTGACGTC
ATAAATTGTATAGCTATGAGTTCACCATCGGCTCTCACTT
GAGTCTGAGGGCCCGTAAATATTACTACAGCAAAACTTGA
ACAGTTTTCTGAGTTCTACACTATGATGTCCTCTTCTGGA
TCTGTTTACTCTCTCTCGCTGTCGTTTGTTCATCAGGGTT
GCACATCTGTGGCCATCTCTGTATCATGTGAATGCTCTTG
TACATGTTTTAATATTTTAGATGCTGTTTATCTGTCCTCT
GTTCTTTGTATAAAAGCTTTTGGATGAGAATCTTTTAACG
TGTAAGAATATTTGAAATAATTTGGTATTCCAAAAATAAA
GATCTTTTTAGACAAAATTTTGGATTGTTAGATACTATTG
AGAAATACAAGTTTATATTCGAGTGTTTAATTAAAATATT
CATGTTTGGAAAGTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations