Transcript

plk1-002

ID
ZDB-TSCRIPT-090929-6840
Name
plk1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023897 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023897|OTTDARG00000019450|ZDB-GENE-021115-7 plk1|no_translation plk1-002 LG_ BX004779.16 Danio rerio protein_coding KNOWN, 330 bp
GTACTTGCACAACAACAGAGTCATTCACCGTGATCTCAAA
CTTGGGAATCTGTTCCTCAATGATGACATGGATGTGAAGA
TCGGTGACTTTGGTTTAGCCACTAAGATTGAGTTTGATGG
GGAGCGAAAGAAGACCCTTTGTGGCACTCCAAACTACATT
GCTCCTGAGGTGCTCTGCAAGAAAGGCCACAGCTTTGAAG
TTGACATTTGGTCACTAGGATGCATTCTTAATTTCTTTTC
TTTATCAGATACACACTGCTGGTTGGAAAGCCTCCATTTG
AGACATCCTGTCTGAAAGAGACCTACATTAGGATTAAGAA
GAATGAGTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations