Transcript

rps18-004

ID
ZDB-TSCRIPT-100915-677
Name
rps18-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046027 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046027|OTTDARG00000032874|ZDB-GENE-020419-20 rps18|no_translation rps18-004 LG_ FP085400.11 Danio rerio protein_coding KNOWN, 781 bp
TCCCTCGTCATCCCAGAGAAGTTTCAGCACATCCTTCGTG
TCCTCAACACGAACATTGATGGAAGACGTAAAATCGCATT
TGCCATCACCGCTATTAAGGGTGTTGGAAGGCGATATGCC
CATGTGGTTCTGAGGAAAGCTGATATTGATTTAAATAAGA
GGGCTGGAGAACTCACTGAGGATGAGGTTGAGAGGGTGGT
GACTATTATGCAGAACCCTCGCCAGTACAAAATCCCAGAC
TGGTTCCTGAACAGACAGAAGGACATAAAAGATGGGAAAT
ACAGCCAGGTATGATTGTCTATTACCATTTTAAAAGTTTA
TCAAGCATGTCTAGCACTGTTTTTCTTGGATGTTATGTGC
TTTAAAAGCAGAAGTTCAGTACAATACCTATAACATGACC
CACAGCTTAAGTTGAGTATGTTTCTGTTTTAACGTGCAAG
TTTTGCTACGATTACGCCTTTCATTTACATTATCCCAGAG
TTTTTGAGCCCTGAAGAGGCCGTTTTTCTTTTTAAAATGC
TGCTGCTCCCTGTCAGTGTGGATGGGTGTAAAACGAAGAC
GTGGCTGTAGACATTCACCTGGAATCTGACTGAAACTTTT
TGCTTAATATTAAGTAGCCTACAGAAAGTTCAGTCTTGCA
TCTTTTAGACTTTGCAAGTTTGATTTGGAAAACAAACTCC
AGGGCCCGGTTTTTCAAAAGGTTTAATCCGGATAAAATTG
ATCCGGATTTAGTAATCCTGTTTTTGCGATCAGTGATCAC
GCAATCCAGCTTACTTTTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations