Transcript

rps18-205

ID
ZDB-TSCRIPT-100915-676
Name
rps18-205
Previous Names
  • rps18-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046024 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046024|OTTDARG00000032874|ZDB-GENE-020419-20 rps18|OTTDARP00000036316 rps18-001 LG_ FP085400.11 Danio rerio protein_coding KNOWN, 683 bp
ATCGCGAGACCATGACAACTTCCTTTTTGCGCGGAACCAG
CGATCAAGATGTCCCTCGTCATCCCAGAGAAGTTTCAGCA
CATCCTTCGTGTCCTCAACACGAACATTGATGGAAGACGT
AAAATCGCATTTGCCATCACCGCTATTAAGGGTGTTGGAA
GGCGATATGCCCATGTGGTTCTGAGGAAAGCTGATATTGA
TTTAAATAAGAGGGCTGGAGAACTCACTGAGGATGAGGTT
GAGAGGGTGGTGACTATTATGCAGAACCCTCGCCAGTACA
AAATCCCAGACTGGTTCCTGAACAGACAGAAGGACATAAA
AGATGGGAAATACAGCCAGGTCCTTGCTAATGGTCTGGAC
AATAAACTGAGAGAAGATCTGGAGAGGCTGAAGAAGATCA
GGGCTCACCGTGGTCTCCGTCACTTCTGGGGTCTGCGTGT
GCGTGGTCAGCACACCAAAACAACTGGTCGTCGCGGTCGC
ACTGTGGGTGTGTCCAAGAAGAAGTAAATTTACAAATAAA
GGAAATCATTCAGTCATTGTGTCAAGTGTTTATTTTTTAA
AATGGTCATGCAATCTAATAATGTTTAAACAAAACGTATA
CTGTGAATTTATGAATCCTGCAGAATCAATCTACCTGAAA
TTATAGTTTTCCTTTAGCTGCATGTAAAATCGCACTTGAG
TAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations