Transcript

rps18-202

ID
ZDB-TSCRIPT-100915-1192
Name
rps18-202
Previous Names
  • rps18-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046025 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046025|OTTDARG00000032874|ZDB-GENE-020419-20 rps18|OTTDARP00000036317 rps18-002 LG_ FP085400.11 Danio rerio protein_coding KNOWN, 572 bp
TGAGTGCGAAATGGTACTCTCAAAGCTTAAGTTGAAATCA
CGCATCATCGGTCTTATTTATCTGTGTACAGTTGTACCGA
TAAAATATTTCCCTCGTCATCCCAGAGAAGTTTCAGCACA
TCCTTCGTGTCCTCAACACGAACATTGATGGAAGACGTAA
AATCGCATTTGCCATCACCGCTATTAAGGGTGTTGGAAGG
CGATATGCCCATGTGGTTCTGAGGAAAGCTGATATTGATT
TAAATAAGAGGGCTGGAGAACTCACTGAGGATGAGGTTGA
GAGGGTGGTGACTATTATGCAGAACCCTCGCCAGTACAAA
ATCCCAGACTGGTTCCTGAACAGACAGAAGGACATAAAAG
ATGGGAAATACAGCCAGGTCCTTGCTAATGGTCTGGACAA
TAAACTGAGAGAAGATCTGGAGAGGCTGAAGAAGATCAGG
GCTCACCGTGGTCTCCGTCACTTCTGGGGTCTGCGTGTGC
GTGGTCAGCACACCAAAACAACTGGTCGTCGCGGTCGCAC
TGTGGGTGTGTCCAAGAAGAAGTAAATTTACAAATAAAGG
AAATCATTCAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations