Transcript

rxraa-201

ID
ZDB-TSCRIPT-091110-1804
Name
rxraa-201
Previous Names
  • gabra1-001
  • rxraa-001
  • ottdart00000043834
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043834 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043834|OTTDARG00000031493|ZDB-GENE-070314-2 rxraa|OTTDARP00000034745 rxraa-001 LG_none BX001031.19,CU062650.13 Danio rerio protein_coding KNOWN, 1380 bp
TAAATGCTTCTTTCTGCTTTCCTCCCCACAGACTGCACTG
GACAGGTGACATCCTCTCCTCTCAGCTCACCCACGTCCCA
CCGGGGCATGCACCCGTCACTGCTGAGTCCAACTTCATTA
GGCCCCTCGGGGTCCCTGCACTCCCCCATCAGCACTCTGA
GCTCACCTATGAATGGCCTGGGCTCTCCCTTCTCCGTCAT
CAGCTCGCCTATGGGGCCTCATTCAATGGCATCTCCTGGA
GTGGGTTACGGCCCCAGTATCAGCCCTCAGTTGAACTCGC
CCATGAACTCTGTCAGCAGCTCAGAGGATATTAAGCCGCC
CTTAGGCCTCAACGGTGTGATGAAGGTTCCAGCCCAGCCC
TCGGGCACCCCACTCTCTCTCACCAAACACATCTGTGCCA
TCTGTGGCGACCGCTCCTCAGGTAAACACTACGGTGTGTA
CAGCTGCGAGGGATGTAAGGGTTTCTTCAAGAGGACAGTG
CGTAAAGACCTGACCTACACCTGTCGAGACAATAAGGACT
GTGTTATAGACAAACGCCAGCGCAACCGCTGCCAGTACTG
CCGCTATCAGAAGTGTTTGGCCATGGGCATGAAGAGAGAA
GCCGTCCAGGAGGAGCGCCAGCGAGCCAAGGAACGCAGTG
AGAACGAAGTGGAGTCGACCAGCAGCGCCAATGAAGACAT
GCCCGTGGAGAAGATACTGGAAGCAGAGCTTGCTGTGGAG
CCCAAGACGGAAACTTACATTGAGACTAATGTACCCATGC
CATCAAATTCACCCAACGATCCAGTCACCAACATTTGTCA
GGCTGCAGACAAGCAGCTCTTTACTCTGGTGGAGTGGGCG
AAGAGGATTCCACACTTTTCTGAGCTCCCGCTTGACGACC
AGGTCATTCTACTACGAGCAGGATGGAATGAGCTCCTCAT
TGCGTCATTTTCGCACCGATCCATAGCAGTGAAAGATGGA
ATACTGTTGGCCACAGGATTACATGTGCACCGAAACAGCG
CCCACAGTGCCGGAGTAGGAGCCATATTTGACAGAGTGCT
GACGGAGTTGGTATCAAAGATGAGAGACATGCAGATGGAT
AAAACAGAGCTTGGATGTCTTCGAGCCATTGTACTATTTA
ACCCAGACTCCAAAGGCCTGTCAAACCCTGGTGAAGTGGA
AGCACTGAGAGAGAAGGTCTATGCCTCTCTGGAAGCTTAC
TGCAAACATAAGTACCCTGAACAACCTGGAAGGTTTGCTA
AGCTGTTGCTGCGGCTCCCTGCACTGCGCTCTATCGGACT
CAAGTGTTTGGAGCATCTGTTCTTCTTCAAGCTCATAGGC
GACACACCCATCGACACCTTCCTCATGGAGATGCTAGAAG
CTCCACACCAAATGACATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations