Transcript

rxraa-003

ID
ZDB-TSCRIPT-091110-1081
Name
rxraa-003
Previous Names
  • dkey-1d7.3-001
  • ottdart00000043836
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043836 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043836|OTTDARG00000031493|ZDB-GENE-070314-2 rxraa|no_translation rxraa-003 LG_none BX001031.19,CU062650.13 Danio rerio protein_coding KNOWN, 658 bp
CCTTCTGTAGCACACACACATACAAATACAGCATTGAGAG
GGAGTTTGGGCAGATTGAGTTGCACGTTGAAAATAGCCGT
ACAGTGATAGAGCCCTCTGATAGTGCAACTCTCCATCTGA
TAGAGACAAACTTAAGAGGTCCAGAAACAGAGTTGAACTC
GCCCATGAACTCTGTCAGCAGCTCAGAGGATATTAAGCCG
CCCTTAGGCCTCAACGGTGTGATGAAGGTTCCAGCCCAGC
CCTCGGGCACCCCACTCTCTCTCACCAAACACATCTGTGC
CATCTGTGGCGACCGCTCCTCAGGTAAACACTACGGTGTG
TACAGCTGCGAGGGATGTAAGGGTTTCTTCAAGAGGACAG
TGCGTAAAGACCTGACCTACACCTGTCGAGACAATAAGGA
CTGTGTTATAGACAAACGCCAGCGCAACCGCTGCCAGTAC
TGCCGCTATCAGAAGTGTTTGGCCATGGGCATGAAGAGAG
AAGCCGTCCAGGAGGAGCGCCAGCGAGCCAAGGAACGCAG
TGAGAACGAAGTGGAGTCGACCAGCAGCGCCAATGAAGAC
ATGCCCGTGGAGAAGATACTGGAAGCAGAGCTTGCTGTGG
AGCCCAAGACGGAAACTTACATTGAGACTAATGTACCCAT
GCCATCAAATTCACCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations