Transcript

exosc8-003

ID
ZDB-TSCRIPT-090929-7160
Name
exosc8-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024292 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024292|OTTDARG00000019701|ZDB-GENE-030131-1736 exosc8|no_translation exosc8-003 LG_ CT573139.21 Danio rerio protein_coding KNOWN, 407 bp
TGGAAACACTACCGTGATCTGTGGGATAAAAGCTGAATTG
GCTGTGCCGCCATCTGAGGCTCAGAATAAAGGATATTTAG
TCCCAAATGTAGATCTGCCCCCGCTGTGCTCGTCCAGATT
CAGAGCTGGTCCACCAGGAGAACAGGCACAGGCTGCCAGC
CAGTTCATCGCAGATGTCATCGAAAGTTCCGATTTAATAA
ATTTGGAGGAACTGTGCATTGAAAAAGCTAAGCTTTGTTG
GGTGCTGTACTGTGATATTATGTGTTTGGATTACGATGGG
AACTTACTTGACGCCTGCATCACAGTTCTGCTGGCAGCTT
TAAAAACCGGTGAGGGCATTTTCTCCCTAAATAACAGTTC
CTTCAGCTGTTATGACCACTAACAAGATCATATTTCTCAG
CACAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations